Orthologous regulated operons containing pfkZ gene
| Regulog: | SmoR - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Sorbitol utilization; Mannitol utilization |
| Effector: | Sorbitol |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Paracoccus denitrificans PD1222 | ||||
|
Position: -122
Score: 5.44952 Sequence: AATTTGACACGCGTAAAATA
Locus tag: Pden_4851
Name: Pden_4851 Funciton: Putative sugar polyol ABC transporter, substrate-binding component
Locus tag: Pden_4850
Name: Pden_4850 Funciton: Putative sugar polyol ABC transporter, ATP-binding protein
Locus tag: Pden_4849
Name: Pden_4849 Funciton: Putative sugar polyol ABC transporter, permease components
Locus tag: Pden_4848
Name: scrK Funciton: Fructokinase (EC 2.7.1.4)
Locus tag: Pden_4847
Name: pfkZ Funciton: 6-phosphofructokinase (EC 2.7.1.11), PF08013 family |
||||
| Pden_4851-Pden_4850-Pden_4849-scrK-pfkZ | -122 | 5.4 | AATTTGACACGCGTAAAATA | Pden_4851 |