Orthologous regulated operons containing COG4633 gene
| Regulog: | CueR - Psychromonadaceae/Aeromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Moritella sp. PE36 | ||||
|
Position: -182
Score: 4.29451 Sequence: GGTTTACCTTAGCTGGAAGGT
Position: -97
Score: 4.77265 Sequence: ACCTTCCAGTTAGGGTAAAGG
Locus tag: PE36_19605
Name: copA2 Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: PE36_19610
Name: COG4633 Funciton: Putative cupredoxin |
||||
| copA2-COG4633 | -182 | 4.3 | GGTTTACCTTAGCTGGAAGGT | PE36_19605 |
| -97 | 4.8 | ACCTTCCAGTTAGGGTAAAGG | ||
| Psychromonas ingrahamii 37 | ||||
|
Position: -69
Score: 4.63413 Sequence: ACCTTCCCCTAAGAGTAATGA
Locus tag: Ping_1381
Name: copA2 Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Ping_1382
Name: COG4633 Funciton: Putative cupredoxin |
||||
| copA2-COG4633 | -69 | 4.6 | ACCTTCCCCTAAGAGTAATGA | Ping_1381 |