Orthologous regulated operons containing aduH gene
Regulog: | AduR - Rhizobiales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | |
Biological process: | Adenosine utilization |
Effector: | Adenosine |
Phylum: | Proteobacteria/Alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Agrobacterium tumefaciens str. C58 (Cereon) | ||||
Position: -36
Score: 7.20731 Sequence: CTGATTAAACGTTTAATCAG
Locus tag: Atu4420
Name: aduR Funciton: Predicted transcriptional regulator for adenosine utilization, LacI family
Locus tag: Atu4421
Name: aduA Funciton: Predicted adenosine ABC transporter, substrate-binding protein
Locus tag: Atu4422
Name: aduB Funciton: Predicted adenosine ABC transporter, permease component 1
Locus tag: Atu4423
Name: aduC Funciton: Predicted adenosine ABC transporter, permease component 2
Locus tag: Atu4424
Name: aduD Funciton: Predicted adenosine ABC transporter, ATP-binding protein
Locus tag: Atu4425
Name: aduH Funciton: putative Adenosine hydrolase (EC 3.2.2.1)
Locus tag: Atu4426
Name: ade Funciton: Adenine deaminase (EC 3.5.4.2) |
||||
aduR-aduA-aduB-aduC-aduD-aduH-ade | -36 | 7.2 | CTGATTAAACGTTTAATCAG | Atu4420 |
Rhizobium etli CFN 42 | ||||
Position: -32
Score: 7.15467 Sequence: CTGATTAAACGATTAATCAG
Locus tag: RHE_CH03414
Name: aduR Funciton: Predicted transcriptional regulator for adenosine utilization, LacI family
Locus tag: RHE_CH03415
Name: aduA Funciton: Predicted adenosine ABC transporter, substrate-binding protein
Locus tag: RHE_CH03416
Name: aduB Funciton: Predicted adenosine ABC transporter, permease component 1
Locus tag: RHE_CH03417
Name: aduC Funciton: Predicted adenosine ABC transporter, permease component 2
Locus tag: RHE_CH03418
Name: aduD Funciton: Predicted adenosine ABC transporter, ATP-binding protein
Locus tag: RHE_CH03419
Name: aduH Funciton: putative Adenosine hydrolase (EC 3.2.2.1)
Locus tag: RHE_CH03420
Name: ade Funciton: Adenine deaminase (EC 3.5.4.2) |
||||
aduR-aduA-aduB-aduC-aduD-aduH-ade | -32 | 7.2 | CTGATTAAACGATTAATCAG | RHE_CH03414 |
Rhizobium leguminosarum bv. viciae 3841 | ||||
Position: -34
Score: 6.84229 Sequence: CTGATTAAACGATTAATCAA
Locus tag: RL3877
Name: aduR Funciton: Predicted transcriptional regulator for adenosine utilization, LacI family
Locus tag: RL3878
Name: aduA Funciton: Predicted adenosine ABC transporter, substrate-binding protein
Locus tag: RL3879
Name: aduB Funciton: Predicted adenosine ABC transporter, permease component 1
Locus tag: RL3880
Name: aduC Funciton: Predicted adenosine ABC transporter, permease component 2
Locus tag: RL3881
Name: aduD Funciton: Predicted adenosine ABC transporter, ATP-binding protein
Locus tag: RL3882
Name: aduH Funciton: putative Adenosine hydrolase (EC 3.2.2.1)
Locus tag: RL3883
Name: ade Funciton: Adenine deaminase (EC 3.5.4.2) |
||||
aduR-aduA-aduB-aduC-aduD-aduH-ade | -34 | 6.8 | CTGATTAAACGATTAATCAA | RL3877 |