Orthologous regulated operons containing aduB gene

Properties
Regulog:	AduR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Adenosine utilization
Effector:	Adenosine
Phylum:	Proteobacteria/Alpha

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -36 Score: 7.20731 Sequence: CTGATTAAACGTTTAATCAG Locus tag: Atu4420 Name: aduR Funciton: Predicted transcriptional regulator for adenosine utilization, LacI family Locus tag: Atu4421 Name: aduA Funciton: Predicted adenosine ABC transporter, substrate-binding protein Locus tag: Atu4422 Name: aduB Funciton: Predicted adenosine ABC transporter, permease component 1 Locus tag: Atu4423 Name: aduC Funciton: Predicted adenosine ABC transporter, permease component 2 Locus tag: Atu4424 Name: aduD Funciton: Predicted adenosine ABC transporter, ATP-binding protein Locus tag: Atu4425 Name: aduH Funciton: putative Adenosine hydrolase (EC 3.2.2.1) Locus tag: Atu4426 Name: ade Funciton: Adenine deaminase (EC 3.5.4.2)
aduR-aduA-aduB-aduC-aduD-aduH-ade	-36	7.2	CTGATTAAACGTTTAATCAG	Atu4420
Rhizobium etli CFN 42
Position: -32 Score: 7.15467 Sequence: CTGATTAAACGATTAATCAG Locus tag: RHE_CH03414 Name: aduR Funciton: Predicted transcriptional regulator for adenosine utilization, LacI family Locus tag: RHE_CH03415 Name: aduA Funciton: Predicted adenosine ABC transporter, substrate-binding protein Locus tag: RHE_CH03416 Name: aduB Funciton: Predicted adenosine ABC transporter, permease component 1 Locus tag: RHE_CH03417 Name: aduC Funciton: Predicted adenosine ABC transporter, permease component 2 Locus tag: RHE_CH03418 Name: aduD Funciton: Predicted adenosine ABC transporter, ATP-binding protein Locus tag: RHE_CH03419 Name: aduH Funciton: putative Adenosine hydrolase (EC 3.2.2.1) Locus tag: RHE_CH03420 Name: ade Funciton: Adenine deaminase (EC 3.5.4.2)
aduR-aduA-aduB-aduC-aduD-aduH-ade	-32	7.2	CTGATTAAACGATTAATCAG	RHE_CH03414
Rhizobium leguminosarum bv. viciae 3841
Position: -34 Score: 6.84229 Sequence: CTGATTAAACGATTAATCAA Locus tag: RL3877 Name: aduR Funciton: Predicted transcriptional regulator for adenosine utilization, LacI family Locus tag: RL3878 Name: aduA Funciton: Predicted adenosine ABC transporter, substrate-binding protein Locus tag: RL3879 Name: aduB Funciton: Predicted adenosine ABC transporter, permease component 1 Locus tag: RL3880 Name: aduC Funciton: Predicted adenosine ABC transporter, permease component 2 Locus tag: RL3881 Name: aduD Funciton: Predicted adenosine ABC transporter, ATP-binding protein Locus tag: RL3882 Name: aduH Funciton: putative Adenosine hydrolase (EC 3.2.2.1) Locus tag: RL3883 Name: ade Funciton: Adenine deaminase (EC 3.5.4.2)
aduR-aduA-aduB-aduC-aduD-aduH-ade	-34	6.8	CTGATTAAACGATTAATCAA	RL3877
Sinorhizobium meliloti 1021
Position: -43 Score: 6.34022 Sequence: CAGCTTAATCGTTTAATCAT Locus tag: SMb21272 Name: aduR Funciton: Predicted transcriptional regulator for adenosine utilization, LacI family Locus tag: SMb21273 Name: aduA Funciton: Predicted adenosine ABC transporter, substrate-binding protein Locus tag: SMb21274 Name: aduB Funciton: Predicted adenosine ABC transporter, permease component 1 Locus tag: SMb21275 Name: aduC Funciton: Predicted adenosine ABC transporter, permease component 2
aduR-aduA-aduB-aduC	-43	6.3	CAGCTTAATCGTTTAATCAT	SMb21272