Orthologous regulated operons containing cueR gene
| Regulog: | CueR - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Photobacterium profundum SS9 | ||||
|
Position: -82
Score: 4.74729 Sequence: ACCTTCTGGTTGGTGTAAGGT
Locus tag: PBPRA2823
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| cueR | -82 | 4.7 | ACCTTCTGGTTGGTGTAAGGT | PBPRA2823 |
| Vibrio angustum S14 | ||||
|
Position: -73
Score: 5.21019 Sequence: ACCTTCTAGTTACTGTAAGGT
Locus tag: VAS14_16481
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| cueR | -73 | 5.2 | ACCTTCTAGTTACTGTAAGGT | VAS14_16481 |
| Vibrio fischeri ES114 | ||||
|
Position: -46
Score: 5.48541 Sequence: ACCTTACAGTTAATGGAAGGT
Locus tag: VF_0782
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| cueR | -46 | 5.5 | ACCTTACAGTTAATGGAAGGT | VF_0782 |
| Vibrio salmonicida LFI1238 | ||||
|
Position: -47
Score: 5.48541 Sequence: ACCTTACAGTAAATGGAAGGT
Locus tag: VSAL_I0803
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| cueR | -47 | 5.5 | ACCTTACAGTAAATGGAAGGT | VSAL_I0803 |