Orthologous regulated operons containing smoS gene
| Regulog: | SmoR - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Sorbitol utilization; Mannitol utilization |
| Effector: | Sorbitol |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Jannaschia sp. CCS1 | ||||
|
Position: -89
Score: 6.40309 Sequence: AAATTTACGCGCGTAAAGTT
Locus tag: Jann_2902
Name: smoE Funciton: Various polyols ABC transporter, substrate-binding protein
Locus tag: Jann_2903
Name: smoF Funciton: Various polyols ABC transporter, inner membrane component 1
Locus tag: Jann_2904
Name: smoG Funciton: ABC sorbitol/mannitol transporter, inner membrane component 2
Locus tag: Jann_2905
Name: smoK Funciton: Various polyols ABC transporter, ATP-binding component
Locus tag: Jann_2906
Name: smoS Funciton: Sorbitol dehydrogenase (EC 1.1.1.14)
Locus tag: Jann_2907
Name: mtlK Funciton: Mannitol dehydrogenase (EC 1.1.1.67) |
||||
| smoE-smoF-smoG-smoK-smoS-mtlK | -89 | 6.4 | AAATTTACGCGCGTAAAGTT | Jann_2902 |
| Oceanicola batsensis HTCC2597 | ||||
|
Position: -104
Score: 5.54523 Sequence: TTCTTTACGCGCGTCAAATT
Locus tag: OB2597_06125
Name: smoE Funciton: Various polyols ABC transporter, substrate-binding protein
Locus tag: OB2597_06130
Name: smoE Funciton: Various polyols ABC transporter, substrate-binding protein
Locus tag: OB2597_06135
Name: smoF Funciton: Various polyols ABC transporter, inner membrane component 1
Locus tag: OB2597_06140
Name: smoG Funciton: ABC sorbitol/mannitol transporter, inner membrane component 2
Locus tag: OB2597_06145
Name: smoK Funciton: Various polyols ABC transporter, ATP-binding component
Locus tag: OB2597_06150
Name: smoS Funciton: Sorbitol dehydrogenase (EC 1.1.1.14)
Locus tag: OB2597_06155
Name: mtlK Funciton: Mannitol dehydrogenase (EC 1.1.1.67)
Locus tag: OB2597_06160
Name: mtlZ Funciton: Fructokinase (EC 2.7.1.4) |
||||
| smoE-smoE-smoF-smoG-smoK-smoS-mtlK-mtlZ | -104 | 5.5 | TTCTTTACGCGCGTCAAATT | OB2597_06125 |
| Paracoccus denitrificans PD1222 | ||||
|
Position: -87
Score: 5.76722 Sequence: AATTTTTCGCGCGTAAAAAT
Locus tag: Pden_4845
Name: smoE Funciton: Various polyols ABC transporter, substrate-binding protein
Locus tag: Pden_4844
Name: smoF Funciton: Various polyols ABC transporter, inner membrane component 1
Locus tag: Pden_4843
Name: smoG Funciton: ABC sorbitol/mannitol transporter, inner membrane component 2
Locus tag: Pden_4842
Name: smoK Funciton: Various polyols ABC transporter, ATP-binding component
Locus tag: Pden_4841
Name: smoS Funciton: Sorbitol dehydrogenase (EC 1.1.1.14)
Locus tag: Pden_4840
Name: smoD Funciton: Putative mannitol dehydrogenase (EC 1.1.1.67), similar to arabinitol dehydrogenase |
||||
| smoE-smoF-smoG-smoK-smoS-smoD | -87 | 5.8 | AATTTTTCGCGCGTAAAAAT | Pden_4845 |
| Silicibacter TM1040 | ||||
|
Position: -89
Score: 5.80599 Sequence: TTCTTTACGCGCGTAAATTT
Locus tag: TM1040_0431
Name: smoE Funciton: Various polyols ABC transporter, substrate-binding protein
Locus tag: TM1040_0430
Name: smoF Funciton: Various polyols ABC transporter, inner membrane component 1
Locus tag: TM1040_0429
Name: smoG Funciton: ABC sorbitol/mannitol transporter, inner membrane component 2
Locus tag: TM1040_0428
Name: smoK Funciton: Various polyols ABC transporter, ATP-binding component
Locus tag: TM1040_0427
Name: smoS Funciton: Sorbitol dehydrogenase (EC 1.1.1.14)
Locus tag: TM1040_0426
Name: mtlK Funciton: Mannitol dehydrogenase (EC 1.1.1.67) |
||||
| smoE-smoF-smoG-smoK-smoS-mtlK | -89 | 5.8 | TTCTTTACGCGCGTAAATTT | TM1040_0431 |