Orthologous regulated operons containing smoF gene

Properties
Regulog:	SmoR - Rhodobacterales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Sorbitol utilization; Mannitol utilization
Effector:	Sorbitol
Phylum:	Proteobacteria/Alpha

Built upon 15 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -89 Score: 6.40309 Sequence: AAATTTACGCGCGTAAAGTT Locus tag: Jann_2902 Name: smoE Funciton: Various polyols ABC transporter, substrate-binding protein Locus tag: Jann_2903 Name: smoF Funciton: Various polyols ABC transporter, inner membrane component 1 Locus tag: Jann_2904 Name: smoG Funciton: ABC sorbitol/mannitol transporter, inner membrane component 2 Locus tag: Jann_2905 Name: smoK Funciton: Various polyols ABC transporter, ATP-binding component Locus tag: Jann_2906 Name: smoS Funciton: Sorbitol dehydrogenase (EC 1.1.1.14) Locus tag: Jann_2907 Name: mtlK Funciton: Mannitol dehydrogenase (EC 1.1.1.67)
smoE-smoF-smoG-smoK-smoS-mtlK	-89	6.4	AAATTTACGCGCGTAAAGTT	Jann_2902
Oceanicola batsensis HTCC2597
Position: -104 Score: 5.54523 Sequence: TTCTTTACGCGCGTCAAATT Locus tag: OB2597_06125 Name: smoE Funciton: Various polyols ABC transporter, substrate-binding protein Locus tag: OB2597_06130 Name: smoE Funciton: Various polyols ABC transporter, substrate-binding protein Locus tag: OB2597_06135 Name: smoF Funciton: Various polyols ABC transporter, inner membrane component 1 Locus tag: OB2597_06140 Name: smoG Funciton: ABC sorbitol/mannitol transporter, inner membrane component 2 Locus tag: OB2597_06145 Name: smoK Funciton: Various polyols ABC transporter, ATP-binding component Locus tag: OB2597_06150 Name: smoS Funciton: Sorbitol dehydrogenase (EC 1.1.1.14) Locus tag: OB2597_06155 Name: mtlK Funciton: Mannitol dehydrogenase (EC 1.1.1.67) Locus tag: OB2597_06160 Name: mtlZ Funciton: Fructokinase (EC 2.7.1.4)
smoE-smoE-smoF-smoG-smoK-smoS-mtlK-mtlZ	-104	5.5	TTCTTTACGCGCGTCAAATT	OB2597_06125
Paracoccus denitrificans PD1222
Position: -87 Score: 5.76722 Sequence: AATTTTTCGCGCGTAAAAAT Locus tag: Pden_4845 Name: smoE Funciton: Various polyols ABC transporter, substrate-binding protein Locus tag: Pden_4844 Name: smoF Funciton: Various polyols ABC transporter, inner membrane component 1 Locus tag: Pden_4843 Name: smoG Funciton: ABC sorbitol/mannitol transporter, inner membrane component 2 Locus tag: Pden_4842 Name: smoK Funciton: Various polyols ABC transporter, ATP-binding component Locus tag: Pden_4841 Name: smoS Funciton: Sorbitol dehydrogenase (EC 1.1.1.14) Locus tag: Pden_4840 Name: smoD Funciton: Putative mannitol dehydrogenase (EC 1.1.1.67), similar to arabinitol dehydrogenase
smoE-smoF-smoG-smoK-smoS-smoD	-87	5.8	AATTTTTCGCGCGTAAAAAT	Pden_4845
Silicibacter TM1040
Position: -89 Score: 5.80599 Sequence: TTCTTTACGCGCGTAAATTT Locus tag: TM1040_0431 Name: smoE Funciton: Various polyols ABC transporter, substrate-binding protein Locus tag: TM1040_0430 Name: smoF Funciton: Various polyols ABC transporter, inner membrane component 1 Locus tag: TM1040_0429 Name: smoG Funciton: ABC sorbitol/mannitol transporter, inner membrane component 2 Locus tag: TM1040_0428 Name: smoK Funciton: Various polyols ABC transporter, ATP-binding component Locus tag: TM1040_0427 Name: smoS Funciton: Sorbitol dehydrogenase (EC 1.1.1.14) Locus tag: TM1040_0426 Name: mtlK Funciton: Mannitol dehydrogenase (EC 1.1.1.67)
smoE-smoF-smoG-smoK-smoS-mtlK	-89	5.8	TTCTTTACGCGCGTAAATTT	TM1040_0431
Sulfitobacter sp. EE-36
Position: -85 Score: 5.76423 Sequence: AACTAGACGCGCGTAAAATT Locus tag: EE36_14652 Name: smoE Funciton: Various polyols ABC transporter, substrate-binding protein Locus tag: EE36_14647 Name: smoF Funciton: Various polyols ABC transporter, inner membrane component 1 Locus tag: EE36_14642 Name: smoG Funciton: ABC sorbitol/mannitol transporter, inner membrane component 2 Locus tag: EE36_14637 Name: smoK Funciton: Various polyols ABC transporter, ATP-binding component Locus tag: EE36_14632 Name: mtlK Funciton: Mannitol dehydrogenase (EC 1.1.1.67) Locus tag: EE36_14627 Name: mtlZ Funciton: Fructokinase (EC 2.7.1.4)
smoE-smoF-smoG-smoK-mtlK-mtlZ	-85	5.8	AACTAGACGCGCGTAAAATT	EE36_14652