Orthologous regulated operons containing COG2271 gene
| Regulog: | SMb20667 - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Rhizobium leguminosarum bv. viciae 3841 | ||||
|
Position: -56
Score: 6.50884 Sequence: TTTTGGCAGCGCTACCAATT
Position: -33
Score: 6.54869 Sequence: CGTTGGCAGCGCTGCCAAAA
Locus tag: pRL120617
Name: COG2271 Funciton: Putative sugar acid transporter, MFS family
Locus tag: pRL120616
Name: ygbJ Funciton: 3-hydroxyacid dehydrogenase/reductase
Locus tag: pRL120615
Name: ygbM Funciton: Hydroxypyruvate isomerase (EC 5.3.1.22)
Locus tag: pRL120614
Name: ygbK Funciton: Uncharacterized protein conserved in bacteria |
||||
| COG2271-ygbJ-ygbM-ygbK | -56 | 6.5 | TTTTGGCAGCGCTACCAATT | pRL120617 |
| -33 | 6.5 | CGTTGGCAGCGCTGCCAAAA | ||
| Rhizobium sp. NGR234 | ||||
|
Position: -136
Score: 6.50884 Sequence: TTTTGGCAGCGCTACCAATT
Position: -113
Score: 6.37894 Sequence: ACTTGGCAGCGCTGCCAAAC
Position: -81
Score: 6.35756 Sequence: TAATGGCAGCGCTGCCATCT
Locus tag: NGR_b20320
Name: COG2271 Funciton: Putative sugar acid transporter, MFS family
Locus tag: NGR_b20330
Name: ygbJ Funciton: 3-hydroxyacid dehydrogenase/reductase
Locus tag: NGR_b20340
Name: ygbM Funciton: Hydroxypyruvate isomerase (EC 5.3.1.22)
Locus tag: NGR_b20350
Name: ygbK Funciton: Uncharacterized protein conserved in bacteria |
||||
| COG2271-ygbJ-ygbM-ygbK | -136 | 6.5 | TTTTGGCAGCGCTACCAATT | NGR_b20320 |
| -113 | 6.4 | ACTTGGCAGCGCTGCCAAAC | ||
| -81 | 6.4 | TAATGGCAGCGCTGCCATCT | ||
| Xanthobacter autotrophicus Py2 | ||||
|
Position: -131
Score: 6.38939 Sequence: TTTTGGCAGCGCTACCATTT
Position: -108
Score: 6.18486 Sequence: GTTTGGCAGCGCTGCCACTG
Position: -76
Score: 6.07063 Sequence: TGATGGCAGCGCTGCCATGC
Locus tag: Xaut_1028
Name: COG2271 Funciton: Putative sugar acid transporter, MFS family
Locus tag: Xaut_1027
Name: ygbJ Funciton: 3-hydroxyacid dehydrogenase/reductase
Locus tag: Xaut_1026
Name: ygbM Funciton: Hydroxypyruvate isomerase (EC 5.3.1.22)
Locus tag: Xaut_1025
Name: ygbK Funciton: Uncharacterized protein conserved in bacteria |
||||
| COG2271-ygbJ-ygbM-ygbK | -131 | 6.4 | TTTTGGCAGCGCTACCATTT | Xaut_1028 |
| -108 | 6.2 | GTTTGGCAGCGCTGCCACTG | ||
| -76 | 6.1 | TGATGGCAGCGCTGCCATGC | ||