Orthologous regulated operons containing rbtR gene
| Regulog: | RbtR - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribitol utilization |
| Effector: | Ribitol |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Rhodobacter sphaeroides 2.4.1 | ||||
|
Position: -95
Score: 5.65811 Sequence: TGGCGCTATCGATTGCGCAA
Position: -73
Score: 5.81606 Sequence: ATGCTCAATCGATGTAGCAT
Locus tag: RSP_3700
Name: rbtR Funciton: Ribitol utilization transcriptional regulator, LacI family |
||||
| rbtR | -95 | 5.7 | TGGCGCTATCGATTGCGCAA | RSP_3700 |
| -73 | 5.8 | ATGCTCAATCGATGTAGCAT | ||