Orthologous regulated operons containing rbtC gene
| Regulog: | RbtR - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribitol utilization |
| Effector: | Ribitol |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Rhodobacter sphaeroides 2.4.1 | ||||
|
Position: -167
Score: 5.81606 Sequence: ATGCTACATCGATTGAGCAT
Position: -145
Score: 5.65811 Sequence: TTGCGCAATCGATAGCGCCA
Locus tag: RSP_3701
Name: rbtA Funciton: Ribitol ABC transporter, periplasmic binding protein
Locus tag: RSP_3702
Name: rbtB Funciton: Ribitol ABC transporter, ATP-binding component
Locus tag: RSP_3703
Name: rbtC Funciton: Ribitol ABC transporter, permease protein
Locus tag: RSP_3704
Name: rbtD Funciton: Ribitol 2-dehydrogenase (EC 1.1.1.56)
Locus tag: RSP_3705
Name: rbtK Funciton: Putative D-ribulokinase (EC 2.7.1.47) |
||||
| rbtA-rbtB-rbtC-rbtD-rbtK | -167 | 5.8 | ATGCTACATCGATTGAGCAT | RSP_3701 |
| -145 | 5.7 | TTGCGCAATCGATAGCGCCA | ||