Orthologous regulated operons containing pyc gene

Properties
Regulog:	PckR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Central carbohydrate metabolism
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 99 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Mesorhizobium loti MAFF303099
Position: -104 Score: 5.33831 Sequence: GATTTAAATCGGTTTAAACC Locus tag: mll3969 Name: pyc Funciton: Pyruvate carboxyl transferase (EC 6.4.1.1)
pyc	-104	5.3	GATTTAAATCGGTTTAAACC	mll3969

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --