Orthologous regulated operons containing Atu4506 gene
| Regulog: | PckR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Central carbohydrate metabolism |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||||
|
Position: -69
Score: 4.05797 Sequence: TGTTTAAATTGTTTAATTGC
Locus tag: Atu4505
Name: pckR Funciton: Transcriptional regulator of phosphoenolpyruvate carboxykinase, LacI family
Locus tag: Atu4506
Name: null Funciton: hypothetical protein
Locus tag: Atu4507
Name: hpr Funciton: Glyoxylate reductase (EC 1.1.1.79) / Hydroxypyruvate reductase (EC 1.1.1.81) |
||||
| pckR-Atu4506-hpr | -69 | 4.1 | TGTTTAAATTGTTTAATTGC | Atu4505 |