Orthologous regulated operons containing COG1735 gene

Properties
Regulog:	RbsR2 - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Phylum:	Proteobacteria/Alpha

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -86 Score: 6.28363 Sequence: CTTGTAAACCGGTTTAGTAA Position: -73 Score: 6.23473 Sequence: TTAGTAAATCGCTTTACAAA Locus tag: Atu3062 Name: rbsR2 Funciton: Transcriptional repressor of ribose utilization, LacI family Locus tag: Atu3063 Name: rbsA Funciton: Ribose ABC transporter, periplasmic ribose-binding protein rbsA Locus tag: Atu3064 Name: rbsB Funciton: Ribose ABC transporter, ATP-binding protein rbsB Locus tag: Atu3065 Name: rbsC Funciton: Ribose ABC transporter, inner membrane protein rbsC Locus tag: Atu3066 Name: COG1735 Funciton: phosphotriesterase-like protein Locus tag: Atu3067 Name: COG5426 Funciton: Uncharacterized membrane protein
rbsR2-rbsA-rbsB-rbsC-COG1735-COG5426	-86	6.3	CTTGTAAACCGGTTTAGTAA	Atu3062
	-73	6.2	TTAGTAAATCGCTTTACAAA
Rhizobium leguminosarum bv. viciae 3841
Position: -44 Score: 6.23737 Sequence: CTTGTAAAGCGCTTTACTAA Position: -31 Score: 5.95978 Sequence: TTACTAAACCGCTTTACAAT Locus tag: pRL90226 Name: rbsR2 Funciton: Transcriptional repressor of ribose utilization, LacI family Locus tag: pRL90225 Name: rbsA Funciton: Ribose ABC transporter, periplasmic ribose-binding protein rbsA Locus tag: pRL90224 Name: rbsB Funciton: Ribose ABC transporter, ATP-binding protein rbsB Locus tag: pRL90223 Name: rbsC Funciton: Ribose ABC transporter, inner membrane protein rbsC Locus tag: pRL90222 Name: COG1735 Funciton: phosphotriesterase-like protein Locus tag: pRL90221 Name: COG5426 Funciton: Uncharacterized membrane protein Locus tag: pRL90220 Name: SSF51366 Funciton: Ribulose-phosphate binding barrel Locus tag: pRL90219 Name: tenA Funciton: Thiaminase II (EC 3.5.99.2) Locus tag: pRL90218 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
rbsR2-rbsA-rbsB-rbsC-COG1735-COG5426-SSF51366-tenA-rbsK	-44	6.2	CTTGTAAAGCGCTTTACTAA	pRL90226
	-31	6	TTACTAAACCGCTTTACAAT