Orthologous regulated operons containing rbsC gene
| Regulog: | RbsR2 - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||||
|
Position: -86
Score: 6.28363 Sequence: CTTGTAAACCGGTTTAGTAA
Position: -73
Score: 6.23473 Sequence: TTAGTAAATCGCTTTACAAA
Locus tag: Atu3062
Name: rbsR2 Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: Atu3063
Name: rbsA Funciton: Ribose ABC transporter, periplasmic ribose-binding protein rbsA
Locus tag: Atu3064
Name: rbsB Funciton: Ribose ABC transporter, ATP-binding protein rbsB
Locus tag: Atu3065
Name: rbsC Funciton: Ribose ABC transporter, inner membrane protein rbsC
Locus tag: Atu3066
Name: COG1735 Funciton: phosphotriesterase-like protein
Locus tag: Atu3067
Name: COG5426 Funciton: Uncharacterized membrane protein |
||||
| rbsR2-rbsA-rbsB-rbsC-COG1735-COG5426 | -86 | 6.3 | CTTGTAAACCGGTTTAGTAA | Atu3062 |
| -73 | 6.2 | TTAGTAAATCGCTTTACAAA | ||
| Rhizobium leguminosarum bv. viciae 3841 | ||||
|
Position: -44
Score: 6.23737 Sequence: CTTGTAAAGCGCTTTACTAA
Position: -31
Score: 5.95978 Sequence: TTACTAAACCGCTTTACAAT
Locus tag: pRL90226
Name: rbsR2 Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: pRL90225
Name: rbsA Funciton: Ribose ABC transporter, periplasmic ribose-binding protein rbsA
Locus tag: pRL90224
Name: rbsB Funciton: Ribose ABC transporter, ATP-binding protein rbsB
Locus tag: pRL90223
Name: rbsC Funciton: Ribose ABC transporter, inner membrane protein rbsC
Locus tag: pRL90222
Name: COG1735 Funciton: phosphotriesterase-like protein
Locus tag: pRL90221
Name: COG5426 Funciton: Uncharacterized membrane protein
Locus tag: pRL90220
Name: SSF51366 Funciton: Ribulose-phosphate binding barrel
Locus tag: pRL90219
Name: tenA Funciton: Thiaminase II (EC 3.5.99.2)
Locus tag: pRL90218
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) |
||||
| rbsR2-rbsA-rbsB-rbsC-COG1735-COG5426-SSF51366-tenA-rbsK | -44 | 6.2 | CTTGTAAAGCGCTTTACTAA | pRL90226 |
| -31 | 6 | TTACTAAACCGCTTTACAAT | ||