Orthologous regulated operons containing rbsB gene
| Regulog: | RbsR2 - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Rhodobacter sphaeroides 2.4.1 | ||||
|
Position: -61
Score: 5.34426 Sequence: CAGATAAACCAGTTTACTAA
Position: -48
Score: 5.67699 Sequence: TTACTAAACCGATTTACTTC
Locus tag: RSP_3686
Name: rbsR2 Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: RSP_3687
Name: rbsA Funciton: Ribose ABC transporter, periplasmic ribose-binding protein rbsA
Locus tag: RSP_3688
Name: rbsB Funciton: Ribose ABC transporter, ATP-binding protein rbsB
Locus tag: RSP_3689
Name: rbsC Funciton: Ribose ABC transporter, inner membrane protein rbsC
Locus tag: RSP_3690
Name: COG1735 Funciton: phosphotriesterase-like protein
Locus tag: RSP_3691
Name: COG5426 Funciton: Uncharacterized membrane protein |
||||
| rbsR2-rbsA-rbsB-rbsC-COG1735-COG5426 | -61 | 5.3 | CAGATAAACCAGTTTACTAA | RSP_3686 |
| -48 | 5.7 | TTACTAAACCGATTTACTTC | ||