Orthologous regulated operons containing AZC_4012 gene
| Regulog: | PckR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Central carbohydrate metabolism |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Rhizobium leguminosarum bv. viciae 3841 | ||||
|
Position: -135
Score: 5.05045 Sequence: GTATCTAAACGATTGAAAAC
Locus tag: RL4439
Name: mdh Funciton: Malate dehydrogenase (EC 1.1.1.37)
Locus tag: RL4438
Name: sucC Funciton: Succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5)
Locus tag: RL4437
Name: RL4437 Funciton: hypothetical protein
Locus tag: RL4436
Name: sucD Funciton: Succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5)
Locus tag: RL4435
Name: sucA Funciton: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2)
Locus tag: RL4434
Name: AZC_4012 Funciton: hypothetical protein
Locus tag: RL4433
Name: sucB Funciton: Dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
||||
| mdh-sucC-RL4437-sucD-sucA-AZC_4012-sucB | -135 | 5.1 | GTATCTAAACGATTGAAAAC | RL4439 |