Orthologous regulated operons containing AZC_4012 gene

Properties
Regulog:	PckR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Central carbohydrate metabolism
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 99 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Rhizobium leguminosarum bv. viciae 3841
Position: -135 Score: 5.05045 Sequence: GTATCTAAACGATTGAAAAC Locus tag: RL4439 Name: mdh Funciton: Malate dehydrogenase (EC 1.1.1.37) Locus tag: RL4438 Name: sucC Funciton: Succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) Locus tag: RL4437 Name: RL4437 Funciton: hypothetical protein Locus tag: RL4436 Name: sucD Funciton: Succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) Locus tag: RL4435 Name: sucA Funciton: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) Locus tag: RL4434 Name: AZC_4012 Funciton: hypothetical protein Locus tag: RL4433 Name: sucB Funciton: Dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61)
mdh-sucC-RL4437-sucD-sucA-AZC_4012-sucB	-135	5.1	GTATCTAAACGATTGAAAAC	RL4439

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --