Orthologous regulated operons containing RL0593 gene
| Regulog: | PckR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Central carbohydrate metabolism |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Mesorhizobium loti MAFF303099 | ||||
|
Position: -179
Score: 4.88667 Sequence: CCATCTAACCGATTGAAAAT
Locus tag: mll4308
Name: mdh Funciton: Malate dehydrogenase (EC 1.1.1.37)
Locus tag: mll4306
Name: sucC Funciton: Succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5)
Locus tag: mll4305
Name: null Funciton: Mannose-6-phosphate isomerase
Locus tag: mll4304
Name: RL4437 Funciton: hypothetical protein
Locus tag: mll4303
Name: sucD Funciton: Succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5)
Locus tag: mll4302
Name: null Funciton: unknown protein
Locus tag: mll4301
Name: sucA Funciton: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2)
Locus tag: mll4300
Name: sucB Funciton: Dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
||||
| mdh-sucC-mll4305-RL4437-sucD-mll4302-sucA-sucB | -179 | 4.9 | CCATCTAACCGATTGAAAAT | mll4308 |