Orthologous regulated operons containing RL0593 gene

Properties
Regulog:	PckR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Central carbohydrate metabolism
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 99 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Mesorhizobium loti MAFF303099
Position: -179 Score: 4.88667 Sequence: CCATCTAACCGATTGAAAAT Locus tag: mll4308 Name: mdh Funciton: Malate dehydrogenase (EC 1.1.1.37) Locus tag: mll4306 Name: sucC Funciton: Succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) Locus tag: mll4305 Name: null Funciton: Mannose-6-phosphate isomerase Locus tag: mll4304 Name: RL4437 Funciton: hypothetical protein Locus tag: mll4303 Name: sucD Funciton: Succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) Locus tag: mll4302 Name: null Funciton: unknown protein Locus tag: mll4301 Name: sucA Funciton: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2) Locus tag: mll4300 Name: sucB Funciton: Dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61)
mdh-sucC-mll4305-RL4437-sucD-mll4302-sucA-sucB	-179	4.9	CCATCTAACCGATTGAAAAT	mll4308

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --