Orthologous regulated operons containing RL4437 gene
Regulog: | PckR - Rhizobiales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Central carbohydrate metabolism |
Effector: | |
Phylum: | Proteobacteria/Alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Mesorhizobium loti MAFF303099 | ||||
Position: -179
Score: 4.88667 Sequence: CCATCTAACCGATTGAAAAT
Locus tag: mll4308
Name: mdh Funciton: Malate dehydrogenase (EC 1.1.1.37)
Locus tag: mll4306
Name: sucC Funciton: Succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5)
Locus tag: mll4305
Name: null Funciton: Mannose-6-phosphate isomerase
Locus tag: mll4304
Name: RL4437 Funciton: hypothetical protein
Locus tag: mll4303
Name: sucD Funciton: Succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5)
Locus tag: mll4302
Name: null Funciton: unknown protein
Locus tag: mll4301
Name: sucA Funciton: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2)
Locus tag: mll4300
Name: sucB Funciton: Dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
||||
mdh-sucC-mll4305-RL4437-sucD-mll4302-sucA-sucB | -179 | 4.9 | CCATCTAACCGATTGAAAAT | mll4308 |
Rhizobium leguminosarum bv. viciae 3841 | ||||
Position: -135
Score: 5.05045 Sequence: GTATCTAAACGATTGAAAAC
Locus tag: RL4439
Name: mdh Funciton: Malate dehydrogenase (EC 1.1.1.37)
Locus tag: RL4438
Name: sucC Funciton: Succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5)
Locus tag: RL4437
Name: RL4437 Funciton: hypothetical protein
Locus tag: RL4436
Name: sucD Funciton: Succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5)
Locus tag: RL4435
Name: sucA Funciton: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2)
Locus tag: RL4434
Name: AZC_4012 Funciton: hypothetical protein
Locus tag: RL4433
Name: sucB Funciton: Dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61) |
||||
mdh-sucC-RL4437-sucD-sucA-AZC_4012-sucB | -135 | 5.1 | GTATCTAAACGATTGAAAAC | RL4439 |