Orthologous regulated operons containing thuK gene
| Regulog: | ThuR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Trehalose utilization |
| Effector: | Trehalose |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||||
|
Position: -210
Score: 6.58951 Sequence: AATTGAAAACGATTTCAATT
Position: -58
Score: 5.00467 Sequence: AGTCAAAAGCGCTTTCAATT
Locus tag: Atu3338
Name: thuE Funciton: Putative trehalose ABC transporter, substrate-binding protein
Locus tag: Atu3339
Name: thuF Funciton: Putative trehalose ABC transporter, inner membrane protein
Locus tag: Atu3340
Name: thuG Funciton: Putative trehalose ABC transporter, inner membrane protein
Locus tag: Atu3341
Name: thuK Funciton: Putative trehalose ABC transporter, ATP-binding protein
Locus tag: Atu3342
Name: thuA Funciton: Trehalose utilization protein ThuA
Locus tag: Atu3343
Name: thuB Funciton: Trehalose utilization oxidoreductase protein ThuB |
||||
| thuE-thuF-thuG-thuK-thuA-thuB | -210 | 6.6 | AATTGAAAACGATTTCAATT | Atu3338 |
| -58 | 5 | AGTCAAAAGCGCTTTCAATT | ||
| Brucella melitensis 16M | ||||
|
Position: -244
Score: 5.84854 Sequence: AATCCAAACCGCTTTCAATC
Position: -75
Score: 5.24342 Sequence: TACCCAAACCGTTTTCGATT
Locus tag: BMEII0945
Name: thuE Funciton: Putative trehalose ABC transporter, substrate-binding protein
Locus tag: BMEII0944
Name: thuF Funciton: Putative trehalose ABC transporter, inner membrane protein
Locus tag: BMEII0943
Name: thuF Funciton: Putative trehalose ABC transporter, inner membrane protein
Locus tag: BMEII0942
Name: thuG Funciton: Putative trehalose ABC transporter, inner membrane protein
Locus tag: BMEII0941
Name: thuK Funciton: Putative trehalose ABC transporter, ATP-binding protein
Locus tag: BMEII0940
Name: thuK Funciton: Putative trehalose ABC transporter, ATP-binding protein
Locus tag: BMEII0939
Name: thuA Funciton: Trehalose utilization protein ThuA
Locus tag: BMEII0938
Name: thuB Funciton: Trehalose utilization oxidoreductase protein ThuB |
||||
| thuE-thuF-thuF-thuG-thuK-thuK-thuA-thuB | -244 | 5.8 | AATCCAAACCGCTTTCAATC | BMEII0945 |
| -75 | 5.2 | TACCCAAACCGTTTTCGATT | ||
| Rhizobium etli CFN 42 | ||||
|
Position: -194
Score: 6.68579 Sequence: AATTGAAATCGATTTCAATT
Position: -34
Score: 5.62053 Sequence: TGTCCAAATCGATTTCAATT
Locus tag: RHE_PF00210
Name: thuE Funciton: Putative trehalose ABC transporter, substrate-binding protein
Locus tag: RHE_PF00209
Name: thuF Funciton: Putative trehalose ABC transporter, inner membrane protein
Locus tag: RHE_PF00208
Name: thuG Funciton: Putative trehalose ABC transporter, inner membrane protein
Locus tag: RHE_PF00207
Name: thuK Funciton: Putative trehalose ABC transporter, ATP-binding protein
Locus tag: RHE_PF00206
Name: thuA Funciton: Trehalose utilization protein ThuA
Locus tag: RHE_PF00205
Name: thuB Funciton: Trehalose utilization oxidoreductase protein ThuB |
||||
| thuE-thuF-thuG-thuK-thuA-thuB | -194 | 6.7 | AATTGAAATCGATTTCAATT | RHE_PF00210 |
| -34 | 5.6 | TGTCCAAATCGATTTCAATT | ||
| Rhizobium sp. NGR234 | ||||
|
Position: -252
Score: 5.16714 Sequence: TAGCCCAATCGTTTTAAATT
Position: -68
Score: 5.09886 Sequence: CAGCCAAACCGTTTTCGAAT
Locus tag: NGR_b23140
Name: thuE Funciton: Putative trehalose ABC transporter, substrate-binding protein
Locus tag: NGR_b23130
Name: thuF Funciton: Putative trehalose ABC transporter, inner membrane protein
Locus tag: NGR_b23120
Name: thuG Funciton: Putative trehalose ABC transporter, inner membrane protein
Locus tag: NGR_b23110
Name: thuK Funciton: Putative trehalose ABC transporter, ATP-binding protein
Locus tag: NGR_b23100
Name: thuA Funciton: Trehalose utilization protein ThuA
Locus tag: NGR_b23090
Name: thuB Funciton: Trehalose utilization oxidoreductase protein ThuB |
||||
| thuE-thuF-thuG-thuK-thuA-thuB | -252 | 5.2 | TAGCCCAATCGTTTTAAATT | NGR_b23140 |
| -68 | 5.1 | CAGCCAAACCGTTTTCGAAT | ||
| Sinorhizobium meliloti 1021 | ||||
|
Position: -258
Score: 5.99126 Sequence: GATCCAAATCGTTTTAAATT
Position: -63
Score: 4.89171 Sequence: TACCCAAACCGTTTTCGAAT
Locus tag: SMb20325
Name: thuE Funciton: Putative trehalose ABC transporter, substrate-binding protein
Locus tag: SMb20326
Name: thuF Funciton: Putative trehalose ABC transporter, inner membrane protein
Locus tag: SMb20327
Name: thuG Funciton: Putative trehalose ABC transporter, inner membrane protein
Locus tag: SMb20328
Name: thuK Funciton: Putative trehalose ABC transporter, ATP-binding protein
Locus tag: SMb20329
Name: thuA Funciton: Trehalose utilization protein ThuA
Locus tag: SMb20330
Name: thuB Funciton: Trehalose utilization oxidoreductase protein ThuB |
||||
| thuE-thuF-thuG-thuK-thuA-thuB | -258 | 6 | GATCCAAATCGTTTTAAATT | SMb20325 |
| -63 | 4.9 | TACCCAAACCGTTTTCGAAT | ||