Orthologous regulated operons containing smtA gene
| Regulog: | NimR - Pasteurellales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Nickel homeostasis |
| Effector: | Nickel ion, (Ni2+) |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Mannheimia succiniciproducens MBEL55E | ||||
|
Position: -60
Score: 6.7025 Sequence: ACCCTGAAGTTACTTCATAGT
Locus tag: MS0467
Name: smtA Funciton: ubiE/COQ5 methyltransferase
Locus tag: MS0466
Name: nikA Funciton: Nickel ABC transporter, periplasmic nickel-binding protein NikA (TC 3.A.1.5.3)
Locus tag: MS0465
Name: nikB Funciton: Nickel transport system permease protein NikB (TC 3.A.1.5.3)
Locus tag: MS0464
Name: nikC Funciton: Nickel transport system permease protein NikC (TC 3.A.1.5.3)
Locus tag: MS0463
Name: nikD Funciton: Nickel transport ATP-binding protein NikD (TC 3.A.1.5.3)
Locus tag: MS0462
Name: nikE Funciton: Nickel transport ATP-binding protein NikE (TC 3.A.1.5.3) |
||||
| smtA-nikA-nikB-nikC-nikD-nikE | -60 | 6.7 | ACCCTGAAGTTACTTCATAGT | MS0467 |