Orthologous regulated operons containing nikM gene
| Regulog: | NimR - Pasteurellales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Nickel homeostasis |
| Effector: | Nickel ion, (Ni2+) |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Actinobacillus succinogenes 130Z | ||||
|
Position: -68
Score: 6.65118 Sequence: ACCCTGAAGTTACTTCATATT
Locus tag: Asuc_0797
Name: nikK Funciton: Additional periplasmic component NikK of nickel ECF transporter
Locus tag: Asuc_0796
Name: nikL Funciton: Additional component NikL of nickel ECF transporter
Locus tag: Asuc_0795
Name: nikM Funciton: Substrate-specific component NikM of nickel ECF transporter
Locus tag: Asuc_0794
Name: nikQ Funciton: Transmembrane component NikQ of energizing module of nickel ECF transporter
Locus tag: Asuc_0793
Name: nikO Funciton: ATPase component NikO of energizing module of nickel ECF transporter |
||||
| nikK-nikL-nikM-nikQ-nikO | -68 | 6.7 | ACCCTGAAGTTACTTCATATT | Asuc_0797 |
| Aggregatibacter aphrophilus NJ8700 | ||||
|
Position: -61
Score: 6.03816 Sequence: ACTCTAAAGTCGCTTCAGATT
Locus tag: NT05HA_1176
Name: nikK Funciton: Additional periplasmic component NikK of nickel ECF transporter
Locus tag: NT05HA_1175
Name: nikL Funciton: Additional component NikL of nickel ECF transporter
Locus tag: NT05HA_1174
Name: nikM Funciton: Substrate-specific component NikM of nickel ECF transporter
Locus tag: NT05HA_1173
Name: nikQ Funciton: Transmembrane component NikQ of energizing module of nickel ECF transporter
Locus tag: NT05HA_1172
Name: nikO Funciton: ATPase component NikO of energizing module of nickel ECF transporter |
||||
| nikK-nikL-nikM-nikQ-nikO | -61 | 6 | ACTCTAAAGTCGCTTCAGATT | NT05HA_1176 |
| Haemophilus influenzae Rd KW20 | ||||
|
Position: -66
Score: 6.41386 Sequence: ATTCTAAAGTTACTTCATATT
Locus tag: HI1624
Name: nikK Funciton: Additional periplasmic component NikK of nickel ECF transporter
Locus tag: HI1622
Name: nikL Funciton: Additional component NikL of nickel ECF transporter
Locus tag: HI1621
Name: nikM Funciton: Substrate-specific component NikM of nickel ECF transporter |
||||
| nikK-nikL-nikM | -66 | 6.4 | ATTCTAAAGTTACTTCATATT | HI1624 |