Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing nikM gene

Properties
Regulog: NimR - Pasteurellales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Nickel homeostasis
Effector: Nickel ion, (Ni2+)
Phylum: Proteobacteria
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Actinobacillus succinogenes 130Z
Position: -68
Score: 6.65118
Sequence: ACCCTGAAGTTACTTCATATT
Locus tag: Asuc_0797
Name: nikK
Funciton: Additional periplasmic component NikK of nickel ECF transporter
Locus tag: Asuc_0796
Name: nikL
Funciton: Additional component NikL of nickel ECF transporter
Locus tag: Asuc_0795
Name: nikM
Funciton: Substrate-specific component NikM of nickel ECF transporter
Locus tag: Asuc_0794
Name: nikQ
Funciton: Transmembrane component NikQ of energizing module of nickel ECF transporter
Locus tag: Asuc_0793
Name: nikO
Funciton: ATPase component NikO of energizing module of nickel ECF transporter
nikK-nikL-nikM-nikQ-nikO -68 6.7 ACCCTGAAGTTACTTCATATT Asuc_0797
Aggregatibacter aphrophilus NJ8700
Position: -61
Score: 6.03816
Sequence: ACTCTAAAGTCGCTTCAGATT
Locus tag: NT05HA_1176
Name: nikK
Funciton: Additional periplasmic component NikK of nickel ECF transporter
Locus tag: NT05HA_1175
Name: nikL
Funciton: Additional component NikL of nickel ECF transporter
Locus tag: NT05HA_1174
Name: nikM
Funciton: Substrate-specific component NikM of nickel ECF transporter
Locus tag: NT05HA_1173
Name: nikQ
Funciton: Transmembrane component NikQ of energizing module of nickel ECF transporter
Locus tag: NT05HA_1172
Name: nikO
Funciton: ATPase component NikO of energizing module of nickel ECF transporter
nikK-nikL-nikM-nikQ-nikO -61 6 ACTCTAAAGTCGCTTCAGATT NT05HA_1176
Haemophilus influenzae Rd KW20
Position: -66
Score: 6.41386
Sequence: ATTCTAAAGTTACTTCATATT
Locus tag: HI1624
Name: nikK
Funciton: Additional periplasmic component NikK of nickel ECF transporter
Locus tag: HI1622
Name: nikL
Funciton: Additional component NikL of nickel ECF transporter
Locus tag: HI1621
Name: nikM
Funciton: Substrate-specific component NikM of nickel ECF transporter
nikK-nikL-nikM -66 6.4 ATTCTAAAGTTACTTCATATT HI1624