Orthologous regulated operons containing nikL gene

Properties
Regulog:	NimR - Pasteurellales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Nickel homeostasis
Effector:	Nickel ion, (Ni2+)
Phylum:	Proteobacteria

Built upon 7 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Actinobacillus succinogenes 130Z
Position: -68 Score: 6.65118 Sequence: ACCCTGAAGTTACTTCATATT Locus tag: Asuc_0797 Name: nikK Funciton: Additional periplasmic component NikK of nickel ECF transporter Locus tag: Asuc_0796 Name: nikL Funciton: Additional component NikL of nickel ECF transporter Locus tag: Asuc_0795 Name: nikM Funciton: Substrate-specific component NikM of nickel ECF transporter Locus tag: Asuc_0794 Name: nikQ Funciton: Transmembrane component NikQ of energizing module of nickel ECF transporter Locus tag: Asuc_0793 Name: nikO Funciton: ATPase component NikO of energizing module of nickel ECF transporter
nikK-nikL-nikM-nikQ-nikO	-68	6.7	ACCCTGAAGTTACTTCATATT	Asuc_0797
Aggregatibacter aphrophilus NJ8700
Position: -61 Score: 6.03816 Sequence: ACTCTAAAGTCGCTTCAGATT Locus tag: NT05HA_1176 Name: nikK Funciton: Additional periplasmic component NikK of nickel ECF transporter Locus tag: NT05HA_1175 Name: nikL Funciton: Additional component NikL of nickel ECF transporter Locus tag: NT05HA_1174 Name: nikM Funciton: Substrate-specific component NikM of nickel ECF transporter Locus tag: NT05HA_1173 Name: nikQ Funciton: Transmembrane component NikQ of energizing module of nickel ECF transporter Locus tag: NT05HA_1172 Name: nikO Funciton: ATPase component NikO of energizing module of nickel ECF transporter
nikK-nikL-nikM-nikQ-nikO	-61	6	ACTCTAAAGTCGCTTCAGATT	NT05HA_1176
Haemophilus influenzae Rd KW20
Position: -66 Score: 6.41386 Sequence: ATTCTAAAGTTACTTCATATT Locus tag: HI1624 Name: nikK Funciton: Additional periplasmic component NikK of nickel ECF transporter Locus tag: HI1622 Name: nikL Funciton: Additional component NikL of nickel ECF transporter Locus tag: HI1621 Name: nikM Funciton: Substrate-specific component NikM of nickel ECF transporter
nikK-nikL-nikM	-66	6.4	ATTCTAAAGTTACTTCATATT	HI1624