Orthologous regulated operons containing phnT gene

Properties
Regulog:	PhnR - Moraxellaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Phylum:	Proteobacteria/gamma

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Acinetobacter baumannii AB0057
Position: -85 Score: 6.43105 Sequence: AATCTGGTTTAAACCAGATT Locus tag: AB57_1568 Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) Locus tag: AB57_1569 Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) Locus tag: AB57_1570 Name: phnU Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
phnS-phnT-phnU	-85	6.4	AATCTGGTTTAAACCAGATT	AB57_1568

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --