Orthologous regulated operons containing RL3595 gene
| Regulog: | RL3595 - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||||
|
Position: -109
Score: 7.04236 Sequence: TAATGGGAACGTTCCCGTTA
Locus tag: Atu5393
Name: RL3595 Funciton: Putative regulator of PF00701, LacI family |
||||
| RL3595 | -109 | 7 | TAATGGGAACGTTCCCGTTA | Atu5393 |
| Azorhizobium caulinodans ORS 571 | ||||
|
Position: -28
Score: 6.65526 Sequence: TAGCGGGAACGTTCCCATCA
Locus tag: AZC_2856
Name: RL3595 Funciton: Putative regulator of PF00701, LacI family |
||||
| RL3595 | -28 | 6.7 | TAGCGGGAACGTTCCCATCA | AZC_2856 |
| Rhizobium etli CFN 42 | ||||
|
Position: -108
Score: 6.90024 Sequence: TATTGGGAACGTTCCCACTA
Locus tag: RHE_CH03150
Name: RL3595 Funciton: Putative regulator of PF00701, LacI family |
||||
| RL3595 | -108 | 6.9 | TATTGGGAACGTTCCCACTA | RHE_CH03150 |
| Rhizobium leguminosarum bv. viciae 3841 | ||||
|
Position: -107
Score: 6.73823 Sequence: TTACGGGAACGTTCCCACTA
Locus tag: RL3595
Name: RL3595 Funciton: Putative regulator of PF00701, LacI family |
||||
| RL3595 | -107 | 6.7 | TTACGGGAACGTTCCCACTA | RL3595 |