Orthologous regulated operons containing PF00083 gene
| Regulog: | RL3595 - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||||
|
Position: -82
Score: 7.04236 Sequence: TAACGGGAACGTTCCCATTA
Locus tag: Atu5394
Name: PF00701 Funciton: Dihydrodipicolinate synthase-like protein
Locus tag: Atu5395
Name: PF00083 Funciton: Putative sugar phosphate permease, MFS superfamily |
||||
| PF00701-PF00083 | -82 | 7 | TAACGGGAACGTTCCCATTA | Atu5394 |
| Azorhizobium caulinodans ORS 571 | ||||
|
Position: -93
Score: 6.65526 Sequence: TGATGGGAACGTTCCCGCTA
Locus tag: AZC_2857
Name: PF00701 Funciton: Dihydrodipicolinate synthase-like protein
Locus tag: AZC_2858
Name: PF00083 Funciton: Putative sugar phosphate permease, MFS superfamily |
||||
| PF00701-PF00083 | -93 | 6.7 | TGATGGGAACGTTCCCGCTA | AZC_2857 |
| Rhizobium etli CFN 42 | ||||
|
Position: -73
Score: 6.90024 Sequence: TAGTGGGAACGTTCCCAATA
Locus tag: RHE_CH03149
Name: PF00701 Funciton: Dihydrodipicolinate synthase-like protein
Locus tag: RHE_CH03148
Name: PF00083 Funciton: Putative sugar phosphate permease, MFS superfamily |
||||
| PF00701-PF00083 | -73 | 6.9 | TAGTGGGAACGTTCCCAATA | RHE_CH03149 |
| Rhizobium leguminosarum bv. viciae 3841 | ||||
|
Position: -74
Score: 6.73823 Sequence: TAGTGGGAACGTTCCCGTAA
Locus tag: RL3594
Name: PF00701 Funciton: Dihydrodipicolinate synthase-like protein
Locus tag: RL3593
Name: PF00083 Funciton: Putative sugar phosphate permease, MFS superfamily |
||||
| PF00701-PF00083 | -74 | 6.7 | TAGTGGGAACGTTCCCGTAA | RL3594 |