Orthologous regulated operons containing aglG gene

Properties
Regulog:	AglR - Rhodobacterales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Alpha-glucosides utilization
Effector:	Alpha-glucoside; Maltose; Sucrose; Trehalose
Phylum:	Proteobacteria/Alpha

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -104 Score: 4.90517 Sequence: ACCCCAAAGCGCTTTGAAAA Locus tag: Jann_1946 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: Jann_1947 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: Jann_1948 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: Jann_1949 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: Jann_1950 Name: aglK Funciton: Alpha-glucoside ABC transporter ATP-binding protein
aglE-aglF-aglG-aglA-aglK	-104	4.9	ACCCCAAAGCGCTTTGAAAA	Jann_1946
Loktanella vestfoldensis SKA53
Position: -112 Score: 6.20408 Sequence: CATCCAAAGCGCTTTGGTAC Locus tag: SKA53_03279 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: SKA53_03284 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: SKA53_03289 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: SKA53_03294 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: SKA53_03299 Name: aglK Funciton: Alpha-glucoside ABC transporter ATP-binding protein
aglE-aglF-aglG-aglA-aglK	-112	6.2	CATCCAAAGCGCTTTGGTAC	SKA53_03279
Oceanicola granulosus HTCC2516
Position: -96 Score: 6.06337 Sequence: CGTCCAAAGCGCTTTGATCC Locus tag: OG2516_02419 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: OG2516_02424 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: OG2516_02429 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: OG2516_02434 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: OG2516_02439 Name: aglK Funciton: Alpha-glucoside ABC transporter ATP-binding protein
aglE-aglF-aglG-aglA-aglK	-96	6.1	CGTCCAAAGCGCTTTGATCC	OG2516_02419
Rhodobacterales bacterium HTCC2654
Position: -97 Score: 5.61932 Sequence: CATCCAAAACGGTTTGGAGC Locus tag: RB2654_03739 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: RB2654_03734 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: RB2654_03729 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: RB2654_03724 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: RB2654_03719 Name: aglK Funciton: Alpha-glucoside ABC transporter ATP-binding protein
aglE-aglF-aglG-aglA-aglK	-97	5.6	CATCCAAAACGGTTTGGAGC	RB2654_03739
Silicibacter TM1040
Position: -257 Score: 5.08268 Sequence: CCTCCAAAGCGCTTTAAAAA Position: -102 Score: 6.3448 Sequence: CAATCAAAGCGCTTTGAATC Locus tag: TM1040_3307 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: TM1040_3306 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: TM1040_3305 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: TM1040_3304 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: TM1040_3303 Name: aglK Funciton: Alpha-glucoside ABC transporter ATP-binding protein
aglE-aglF-aglG-aglA-aglK	-257	5.1	CCTCCAAAGCGCTTTAAAAA	TM1040_3307
	-102	6.3	CAATCAAAGCGCTTTGAATC