Orthologous regulated operons containing aglF gene
| Regulog: | AglR - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Alpha-glucosides utilization |
| Effector: | Alpha-glucoside; Maltose; Sucrose; Trehalose |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Jannaschia sp. CCS1 | ||||
|
Position: -104
Score: 4.90517 Sequence: ACCCCAAAGCGCTTTGAAAA
Locus tag: Jann_1946
Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
Locus tag: Jann_1947
Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: Jann_1948
Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: Jann_1949
Name: aglA Funciton: Alpha-glucosidase AglA
Locus tag: Jann_1950
Name: aglK Funciton: Alpha-glucoside ABC transporter ATP-binding protein |
||||
| aglE-aglF-aglG-aglA-aglK | -104 | 4.9 | ACCCCAAAGCGCTTTGAAAA | Jann_1946 |
| Loktanella vestfoldensis SKA53 | ||||
|
Position: -112
Score: 6.20408 Sequence: CATCCAAAGCGCTTTGGTAC
Locus tag: SKA53_03279
Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
Locus tag: SKA53_03284
Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: SKA53_03289
Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: SKA53_03294
Name: aglA Funciton: Alpha-glucosidase AglA
Locus tag: SKA53_03299
Name: aglK Funciton: Alpha-glucoside ABC transporter ATP-binding protein |
||||
| aglE-aglF-aglG-aglA-aglK | -112 | 6.2 | CATCCAAAGCGCTTTGGTAC | SKA53_03279 |
| Oceanicola granulosus HTCC2516 | ||||
|
Position: -96
Score: 6.06337 Sequence: CGTCCAAAGCGCTTTGATCC
Locus tag: OG2516_02419
Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
Locus tag: OG2516_02424
Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: OG2516_02429
Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: OG2516_02434
Name: aglA Funciton: Alpha-glucosidase AglA
Locus tag: OG2516_02439
Name: aglK Funciton: Alpha-glucoside ABC transporter ATP-binding protein |
||||
| aglE-aglF-aglG-aglA-aglK | -96 | 6.1 | CGTCCAAAGCGCTTTGATCC | OG2516_02419 |
| Rhodobacterales bacterium HTCC2654 | ||||
|
Position: -97
Score: 5.61932 Sequence: CATCCAAAACGGTTTGGAGC
Locus tag: RB2654_03739
Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
Locus tag: RB2654_03734
Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: RB2654_03729
Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: RB2654_03724
Name: aglA Funciton: Alpha-glucosidase AglA
Locus tag: RB2654_03719
Name: aglK Funciton: Alpha-glucoside ABC transporter ATP-binding protein |
||||
| aglE-aglF-aglG-aglA-aglK | -97 | 5.6 | CATCCAAAACGGTTTGGAGC | RB2654_03739 |
| Silicibacter TM1040 | ||||
|
Position: -257
Score: 5.08268 Sequence: CCTCCAAAGCGCTTTAAAAA
Position: -102
Score: 6.3448 Sequence: CAATCAAAGCGCTTTGAATC
Locus tag: TM1040_3307
Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
Locus tag: TM1040_3306
Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: TM1040_3305
Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: TM1040_3304
Name: aglA Funciton: Alpha-glucosidase AglA
Locus tag: TM1040_3303
Name: aglK Funciton: Alpha-glucoside ABC transporter ATP-binding protein |
||||
| aglE-aglF-aglG-aglA-aglK | -257 | 5.1 | CCTCCAAAGCGCTTTAAAAA | TM1040_3307 |
| -102 | 6.3 | CAATCAAAGCGCTTTGAATC | ||