Orthologous regulated operons containing ywoC gene
| Regulog: | YtrA - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Ramoplanin resistance |
| Effector: | Ramoplanin |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | ||||
|
Position: -34
Score: 6.61195 Sequence: TGTACTACATCAAATAATACA
Locus tag: BSU36500
Name: ywoB Funciton: Putative integral inner membrane protein
Locus tag: BSU36490
Name: ywoC Funciton: Nicotinamidase/isochorismatase family protein
Locus tag: BSU36480
Name: ywoD Funciton: drug resistance transporter, EmrB/QacA family |
||||
| ywoB-ywoC-ywoD | -34 | 6.6 | TGTACTACATCAAATAATACA | BSU36500 |