Orthologous regulated operons containing ywoD gene
Regulog: | YtrA - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Ramoplanin resistance |
Effector: | Ramoplanin |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bacillus subtilis subsp. subtilis str. 168 | ||||
Position: -34
Score: 6.61195 Sequence: TGTACTACATCAAATAATACA
Locus tag: BSU36500
Name: ywoB Funciton: Putative integral inner membrane protein
Locus tag: BSU36490
Name: ywoC Funciton: Nicotinamidase/isochorismatase family protein
Locus tag: BSU36480
Name: ywoD Funciton: drug resistance transporter, EmrB/QacA family |
||||
ywoB-ywoC-ywoD | -34 | 6.6 | TGTACTACATCAAATAATACA | BSU36500 |