Orthologous regulated operons containing PF01297 gene

Properties
Regulog:	Fur - Vibrionales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 447 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -87 Score: 5.27092 Sequence: CAATGAAAACGATTATCAATT Locus tag: PBPRB1213 Name: PF03929 Funciton: Uncharacterized protein involved in iron uptake Locus tag: PBPRB1212 Name: PF10029 Funciton: Predicted periplasmic protein (DUF2271) Locus tag: PBPRB1211 Name: cbiM Funciton: ABC-type Co2+ transport system, periplasmic component Locus tag: PBPRB1210 Name: VIBHAR_06747 Funciton: conserved hypothetical protein Locus tag: PBPRB1209 Name: VIBHAR_06746 Funciton: conserved hypothetical protein Locus tag: PBPRB1208 Name: PF01297 Funciton: ABC transporter, metal-binding lipoprotein Locus tag: PBPRB1207 Name: COG1121 Funciton: ABC-type Mn/Zn transport systems, ATPase component Locus tag: PBPRB1206 Name: COG1108 Funciton: ABC-type Mn2+/Zn2+ transport systems, permease components Locus tag: PBPRB1205 Name: COG0803 Funciton: ABC-type metal ion transport system, periplasmic component/surface adhesin
PF03929-PF10029-cbiM-VIBHAR_06747-VIBHAR_06746-PF01297-COG1121-COG1108-COG0803	-87	5.3	CAATGAAAACGATTATCAATT	PBPRB1213
Vibrio angustum S14
Position: -61 Score: 5.2234 Sequence: CAATAAGAACGATTATCAATT Locus tag: VAS14_12444 Name: PF03929 Funciton: Uncharacterized protein involved in iron uptake Locus tag: VAS14_12439 Name: PF10029 Funciton: Predicted periplasmic protein (DUF2271) Locus tag: VAS14_12434 Name: cbiM Funciton: ABC-type Co2+ transport system, periplasmic component Locus tag: VAS14_12429 Name: VIBHAR_06747 Funciton: conserved hypothetical protein Locus tag: VAS14_12424 Name: VIBHAR_06746 Funciton: conserved hypothetical protein Locus tag: VAS14_12419 Name: PF01297 Funciton: ABC transporter, metal-binding lipoprotein Locus tag: VAS14_12414 Name: COG1121 Funciton: ABC-type Mn/Zn transport systems, ATPase component Locus tag: VAS14_12409 Name: COG1108 Funciton: ABC-type Mn2+/Zn2+ transport systems, permease components Locus tag: VAS14_12404 Name: COG0803 Funciton: ABC-type metal ion transport system, periplasmic component/surface adhesin
PF03929-PF10029-cbiM-VIBHAR_06747-VIBHAR_06746-PF01297-COG1121-COG1108-COG0803	-61	5.2	CAATAAGAACGATTATCAATT	VAS14_12444
Vibrio parahaemolyticus RIMD 2210633
Position: -59 Score: 4.86504 Sequence: CAATAAGAATGATTATCACCT Locus tag: VPA0157 Name: PF03929 Funciton: Uncharacterized protein involved in iron uptake Locus tag: VPA0158 Name: PF10029 Funciton: Predicted periplasmic protein (DUF2271) Locus tag: VPA0159 Name: cbiM Funciton: ABC-type Co2+ transport system, periplasmic component Locus tag: VPA0160 Name: VIBHAR_06747 Funciton: conserved hypothetical protein Locus tag: VPA0161 Name: VIBHAR_06746 Funciton: conserved hypothetical protein Locus tag: VPA0162 Name: PF01297 Funciton: ABC transporter, metal-binding lipoprotein Locus tag: VPA0163 Name: COG1121 Funciton: ABC-type Mn/Zn transport systems, ATPase component Locus tag: VPA0164 Name: COG1108 Funciton: ABC-type Mn2+/Zn2+ transport systems, permease components Locus tag: VPA0165 Name: COG0803 Funciton: ABC-type metal ion transport system, periplasmic component/surface adhesin
PF03929-PF10029-cbiM-VIBHAR_06747-VIBHAR_06746-PF01297-COG1121-COG1108-COG0803	-59	4.9	CAATAAGAATGATTATCACCT	VPA0157
Vibrio salmonicida LFI1238
Position: -61 Score: 4.69492 Sequence: CAACGCAAATCATTATCAATT Locus tag: VSAL_II0118 Name: PF03929 Funciton: Uncharacterized protein involved in iron uptake Locus tag: VSAL_II0119 Name: PF10029 Funciton: Predicted periplasmic protein (DUF2271) Locus tag: VSAL_II0120 Name: cbiM Funciton: ABC-type Co2+ transport system, periplasmic component Locus tag: VSAL_II0121 Name: VIBHAR_06747 Funciton: conserved hypothetical protein Locus tag: VSAL_II0122 Name: VIBHAR_06746 Funciton: conserved hypothetical protein Locus tag: VSAL_II0123 Name: PF01297 Funciton: ABC transporter, metal-binding lipoprotein Locus tag: VSAL_II0124 Name: COG1121 Funciton: ABC-type Mn/Zn transport systems, ATPase component Locus tag: VSAL_II0125 Name: COG1108 Funciton: ABC-type Mn2+/Zn2+ transport systems, permease components Locus tag: VSAL_II0126 Name: COG0803 Funciton: ABC-type metal ion transport system, periplasmic component/surface adhesin
PF03929-PF10029-cbiM-VIBHAR_06747-VIBHAR_06746-PF01297-COG1121-COG1108-COG0803	-61	4.7	CAACGCAAATCATTATCAATT	VSAL_II0118
Vibrio splendidus LGP32
Position: -57 Score: 4.84533 Sequence: CAATACGAATTATTATCAACT Locus tag: VS_II0685 Name: PF03929 Funciton: Uncharacterized protein involved in iron uptake Locus tag: VS_II0686 Name: PF10029 Funciton: Predicted periplasmic protein (DUF2271) Locus tag: VS_II0687 Name: cbiM Funciton: ABC-type Co2+ transport system, periplasmic component Locus tag: VS_II0688 Name: VIBHAR_06747 Funciton: conserved hypothetical protein Locus tag: VS_II0689 Name: VIBHAR_06746 Funciton: conserved hypothetical protein Locus tag: VS_II0690 Name: PF01297 Funciton: ABC transporter, metal-binding lipoprotein Locus tag: VS_II0691 Name: COG1121 Funciton: ABC-type Mn/Zn transport systems, ATPase component Locus tag: VS_II0692 Name: COG1108 Funciton: ABC-type Mn2+/Zn2+ transport systems, permease components Locus tag: VS_II0693 Name: COG0803 Funciton: ABC-type metal ion transport system, periplasmic component/surface adhesin
PF03929-PF10029-cbiM-VIBHAR_06747-VIBHAR_06746-PF01297-COG1121-COG1108-COG0803	-57	4.8	CAATACGAATTATTATCAACT	VS_II0685