Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing cbiM gene

Properties
Regulog: Fur - Vibrionales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 447 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -87
Score: 5.27092
Sequence: CAATGAAAACGATTATCAATT
Locus tag: PBPRB1213
Name: PF03929
Funciton: Uncharacterized protein involved in iron uptake
Locus tag: PBPRB1212
Name: PF10029
Funciton: Predicted periplasmic protein (DUF2271)
Locus tag: PBPRB1211
Name: cbiM
Funciton: ABC-type Co2+ transport system, periplasmic component
Locus tag: PBPRB1210
Name: VIBHAR_06747
Funciton: conserved hypothetical protein
Locus tag: PBPRB1209
Name: VIBHAR_06746
Funciton: conserved hypothetical protein
Locus tag: PBPRB1208
Name: PF01297
Funciton: ABC transporter, metal-binding lipoprotein
Locus tag: PBPRB1207
Name: COG1121
Funciton: ABC-type Mn/Zn transport systems, ATPase component
Locus tag: PBPRB1206
Name: COG1108
Funciton: ABC-type Mn2+/Zn2+ transport systems, permease components
Locus tag: PBPRB1205
Name: COG0803
Funciton: ABC-type metal ion transport system, periplasmic component/surface adhesin
PF03929-PF10029-cbiM-VIBHAR_06747-VIBHAR_06746-PF01297-COG1121-COG1108-COG0803 -87 5.3 CAATGAAAACGATTATCAATT PBPRB1213
Vibrio angustum S14
Position: -61
Score: 5.2234
Sequence: CAATAAGAACGATTATCAATT
Locus tag: VAS14_12444
Name: PF03929
Funciton: Uncharacterized protein involved in iron uptake
Locus tag: VAS14_12439
Name: PF10029
Funciton: Predicted periplasmic protein (DUF2271)
Locus tag: VAS14_12434
Name: cbiM
Funciton: ABC-type Co2+ transport system, periplasmic component
Locus tag: VAS14_12429
Name: VIBHAR_06747
Funciton: conserved hypothetical protein
Locus tag: VAS14_12424
Name: VIBHAR_06746
Funciton: conserved hypothetical protein
Locus tag: VAS14_12419
Name: PF01297
Funciton: ABC transporter, metal-binding lipoprotein
Locus tag: VAS14_12414
Name: COG1121
Funciton: ABC-type Mn/Zn transport systems, ATPase component
Locus tag: VAS14_12409
Name: COG1108
Funciton: ABC-type Mn2+/Zn2+ transport systems, permease components
Locus tag: VAS14_12404
Name: COG0803
Funciton: ABC-type metal ion transport system, periplasmic component/surface adhesin
PF03929-PF10029-cbiM-VIBHAR_06747-VIBHAR_06746-PF01297-COG1121-COG1108-COG0803 -61 5.2 CAATAAGAACGATTATCAATT VAS14_12444
Vibrio parahaemolyticus RIMD 2210633
Position: -59
Score: 4.86504
Sequence: CAATAAGAATGATTATCACCT
Locus tag: VPA0157
Name: PF03929
Funciton: Uncharacterized protein involved in iron uptake
Locus tag: VPA0158
Name: PF10029
Funciton: Predicted periplasmic protein (DUF2271)
Locus tag: VPA0159
Name: cbiM
Funciton: ABC-type Co2+ transport system, periplasmic component
Locus tag: VPA0160
Name: VIBHAR_06747
Funciton: conserved hypothetical protein
Locus tag: VPA0161
Name: VIBHAR_06746
Funciton: conserved hypothetical protein
Locus tag: VPA0162
Name: PF01297
Funciton: ABC transporter, metal-binding lipoprotein
Locus tag: VPA0163
Name: COG1121
Funciton: ABC-type Mn/Zn transport systems, ATPase component
Locus tag: VPA0164
Name: COG1108
Funciton: ABC-type Mn2+/Zn2+ transport systems, permease components
Locus tag: VPA0165
Name: COG0803
Funciton: ABC-type metal ion transport system, periplasmic component/surface adhesin
PF03929-PF10029-cbiM-VIBHAR_06747-VIBHAR_06746-PF01297-COG1121-COG1108-COG0803 -59 4.9 CAATAAGAATGATTATCACCT VPA0157
Vibrio salmonicida LFI1238
Position: -61
Score: 4.69492
Sequence: CAACGCAAATCATTATCAATT
Locus tag: VSAL_II0118
Name: PF03929
Funciton: Uncharacterized protein involved in iron uptake
Locus tag: VSAL_II0119
Name: PF10029
Funciton: Predicted periplasmic protein (DUF2271)
Locus tag: VSAL_II0120
Name: cbiM
Funciton: ABC-type Co2+ transport system, periplasmic component
Locus tag: VSAL_II0121
Name: VIBHAR_06747
Funciton: conserved hypothetical protein
Locus tag: VSAL_II0122
Name: VIBHAR_06746
Funciton: conserved hypothetical protein
Locus tag: VSAL_II0123
Name: PF01297
Funciton: ABC transporter, metal-binding lipoprotein
Locus tag: VSAL_II0124
Name: COG1121
Funciton: ABC-type Mn/Zn transport systems, ATPase component
Locus tag: VSAL_II0125
Name: COG1108
Funciton: ABC-type Mn2+/Zn2+ transport systems, permease components
Locus tag: VSAL_II0126
Name: COG0803
Funciton: ABC-type metal ion transport system, periplasmic component/surface adhesin
PF03929-PF10029-cbiM-VIBHAR_06747-VIBHAR_06746-PF01297-COG1121-COG1108-COG0803 -61 4.7 CAACGCAAATCATTATCAATT VSAL_II0118
Vibrio splendidus LGP32
Position: -57
Score: 4.84533
Sequence: CAATACGAATTATTATCAACT
Locus tag: VS_II0685
Name: PF03929
Funciton: Uncharacterized protein involved in iron uptake
Locus tag: VS_II0686
Name: PF10029
Funciton: Predicted periplasmic protein (DUF2271)
Locus tag: VS_II0687
Name: cbiM
Funciton: ABC-type Co2+ transport system, periplasmic component
Locus tag: VS_II0688
Name: VIBHAR_06747
Funciton: conserved hypothetical protein
Locus tag: VS_II0689
Name: VIBHAR_06746
Funciton: conserved hypothetical protein
Locus tag: VS_II0690
Name: PF01297
Funciton: ABC transporter, metal-binding lipoprotein
Locus tag: VS_II0691
Name: COG1121
Funciton: ABC-type Mn/Zn transport systems, ATPase component
Locus tag: VS_II0692
Name: COG1108
Funciton: ABC-type Mn2+/Zn2+ transport systems, permease components
Locus tag: VS_II0693
Name: COG0803
Funciton: ABC-type metal ion transport system, periplasmic component/surface adhesin
PF03929-PF10029-cbiM-VIBHAR_06747-VIBHAR_06746-PF01297-COG1121-COG1108-COG0803 -57 4.8 CAATACGAATTATTATCAACT VS_II0685