Orthologous regulated operons containing PF03929 gene
Regulog: | Fur - Vibrionales |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor (activator) |
Biological process: | Iron homeostasis |
Effector: | Iron ion, (Fe2+) |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Photobacterium profundum SS9 | ||||
Position: -87
Score: 5.27092 Sequence: CAATGAAAACGATTATCAATT
Locus tag: PBPRB1213
Name: PF03929 Funciton: Uncharacterized protein involved in iron uptake
Locus tag: PBPRB1212
Name: PF10029 Funciton: Predicted periplasmic protein (DUF2271)
Locus tag: PBPRB1211
Name: cbiM Funciton: ABC-type Co2+ transport system, periplasmic component
Locus tag: PBPRB1210
Name: VIBHAR_06747 Funciton: conserved hypothetical protein
Locus tag: PBPRB1209
Name: VIBHAR_06746 Funciton: conserved hypothetical protein
Locus tag: PBPRB1208
Name: PF01297 Funciton: ABC transporter, metal-binding lipoprotein
Locus tag: PBPRB1207
Name: COG1121 Funciton: ABC-type Mn/Zn transport systems, ATPase component
Locus tag: PBPRB1206
Name: COG1108 Funciton: ABC-type Mn2+/Zn2+ transport systems, permease components
Locus tag: PBPRB1205
Name: COG0803 Funciton: ABC-type metal ion transport system, periplasmic component/surface adhesin |
||||
PF03929-PF10029-cbiM-VIBHAR_06747-VIBHAR_06746-PF01297-COG1121-COG1108-COG0803 | -87 | 5.3 | CAATGAAAACGATTATCAATT | PBPRB1213 |
Vibrio angustum S14 | ||||
Position: -61
Score: 5.2234 Sequence: CAATAAGAACGATTATCAATT
Locus tag: VAS14_12444
Name: PF03929 Funciton: Uncharacterized protein involved in iron uptake
Locus tag: VAS14_12439
Name: PF10029 Funciton: Predicted periplasmic protein (DUF2271)
Locus tag: VAS14_12434
Name: cbiM Funciton: ABC-type Co2+ transport system, periplasmic component
Locus tag: VAS14_12429
Name: VIBHAR_06747 Funciton: conserved hypothetical protein
Locus tag: VAS14_12424
Name: VIBHAR_06746 Funciton: conserved hypothetical protein
Locus tag: VAS14_12419
Name: PF01297 Funciton: ABC transporter, metal-binding lipoprotein
Locus tag: VAS14_12414
Name: COG1121 Funciton: ABC-type Mn/Zn transport systems, ATPase component
Locus tag: VAS14_12409
Name: COG1108 Funciton: ABC-type Mn2+/Zn2+ transport systems, permease components
Locus tag: VAS14_12404
Name: COG0803 Funciton: ABC-type metal ion transport system, periplasmic component/surface adhesin |
||||
PF03929-PF10029-cbiM-VIBHAR_06747-VIBHAR_06746-PF01297-COG1121-COG1108-COG0803 | -61 | 5.2 | CAATAAGAACGATTATCAATT | VAS14_12444 |
Vibrio parahaemolyticus RIMD 2210633 | ||||
Position: -59
Score: 4.86504 Sequence: CAATAAGAATGATTATCACCT
Locus tag: VPA0157
Name: PF03929 Funciton: Uncharacterized protein involved in iron uptake
Locus tag: VPA0158
Name: PF10029 Funciton: Predicted periplasmic protein (DUF2271)
Locus tag: VPA0159
Name: cbiM Funciton: ABC-type Co2+ transport system, periplasmic component
Locus tag: VPA0160
Name: VIBHAR_06747 Funciton: conserved hypothetical protein
Locus tag: VPA0161
Name: VIBHAR_06746 Funciton: conserved hypothetical protein
Locus tag: VPA0162
Name: PF01297 Funciton: ABC transporter, metal-binding lipoprotein
Locus tag: VPA0163
Name: COG1121 Funciton: ABC-type Mn/Zn transport systems, ATPase component
Locus tag: VPA0164
Name: COG1108 Funciton: ABC-type Mn2+/Zn2+ transport systems, permease components
Locus tag: VPA0165
Name: COG0803 Funciton: ABC-type metal ion transport system, periplasmic component/surface adhesin |
||||
PF03929-PF10029-cbiM-VIBHAR_06747-VIBHAR_06746-PF01297-COG1121-COG1108-COG0803 | -59 | 4.9 | CAATAAGAATGATTATCACCT | VPA0157 |
Vibrio salmonicida LFI1238 | ||||
Position: -61
Score: 4.69492 Sequence: CAACGCAAATCATTATCAATT
Locus tag: VSAL_II0118
Name: PF03929 Funciton: Uncharacterized protein involved in iron uptake
Locus tag: VSAL_II0119
Name: PF10029 Funciton: Predicted periplasmic protein (DUF2271)
Locus tag: VSAL_II0120
Name: cbiM Funciton: ABC-type Co2+ transport system, periplasmic component
Locus tag: VSAL_II0121
Name: VIBHAR_06747 Funciton: conserved hypothetical protein
Locus tag: VSAL_II0122
Name: VIBHAR_06746 Funciton: conserved hypothetical protein
Locus tag: VSAL_II0123
Name: PF01297 Funciton: ABC transporter, metal-binding lipoprotein
Locus tag: VSAL_II0124
Name: COG1121 Funciton: ABC-type Mn/Zn transport systems, ATPase component
Locus tag: VSAL_II0125
Name: COG1108 Funciton: ABC-type Mn2+/Zn2+ transport systems, permease components
Locus tag: VSAL_II0126
Name: COG0803 Funciton: ABC-type metal ion transport system, periplasmic component/surface adhesin |
||||
PF03929-PF10029-cbiM-VIBHAR_06747-VIBHAR_06746-PF01297-COG1121-COG1108-COG0803 | -61 | 4.7 | CAACGCAAATCATTATCAATT | VSAL_II0118 |
Vibrio splendidus LGP32 | ||||
Position: -57
Score: 4.84533 Sequence: CAATACGAATTATTATCAACT
Locus tag: VS_II0685
Name: PF03929 Funciton: Uncharacterized protein involved in iron uptake
Locus tag: VS_II0686
Name: PF10029 Funciton: Predicted periplasmic protein (DUF2271)
Locus tag: VS_II0687
Name: cbiM Funciton: ABC-type Co2+ transport system, periplasmic component
Locus tag: VS_II0688
Name: VIBHAR_06747 Funciton: conserved hypothetical protein
Locus tag: VS_II0689
Name: VIBHAR_06746 Funciton: conserved hypothetical protein
Locus tag: VS_II0690
Name: PF01297 Funciton: ABC transporter, metal-binding lipoprotein
Locus tag: VS_II0691
Name: COG1121 Funciton: ABC-type Mn/Zn transport systems, ATPase component
Locus tag: VS_II0692
Name: COG1108 Funciton: ABC-type Mn2+/Zn2+ transport systems, permease components
Locus tag: VS_II0693
Name: COG0803 Funciton: ABC-type metal ion transport system, periplasmic component/surface adhesin |
||||
PF03929-PF10029-cbiM-VIBHAR_06747-VIBHAR_06746-PF01297-COG1121-COG1108-COG0803 | -57 | 4.8 | CAATACGAATTATTATCAACT | VS_II0685 |