Orthologous regulated operons containing fhuB gene

Properties
Regulog:	Fur - Vibrionales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 447 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Vibrio cholerae O1 biovar eltor str. N16961
Position: -54 Score: 5.23312 Sequence: AATTGAGAAAGATTCGCAATT Position: -24 Score: 4.49305 Sequence: TAATTAAGATAATTATCACTA Locus tag: VC0200 Name: fhuA Funciton: TonB-dependent outer membrane receptor for iron siderophores Locus tag: VC0201 Name: fhuC Funciton: Ferrichrome transport ATP-binding protein FhuC Locus tag: VC0202 Name: fhuD Funciton: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3) Locus tag: VC0203 Name: fhuB Funciton: Ferrichrome transport system permease protein FhuB
fhuA-fhuC-fhuD-fhuB	-54	5.2	AATTGAGAAAGATTCGCAATT	VC0200
	-24	4.5	TAATTAAGATAATTATCACTA
Vibrio harveyi ATCC BAA-1116
Position: -48 Score: 5.55221 Sequence: AAATGAGATTTATTACTATTT Locus tag: VIBHAR_06299 Name: fhuA Funciton: TonB-dependent outer membrane receptor for iron siderophores Locus tag: VIBHAR_06298 Name: fhuD Funciton: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3) Locus tag: VIBHAR_06297 Name: fhuB Funciton: Ferrichrome transport system permease protein FhuB
fhuA-fhuD-fhuB	-48	5.6	AAATGAGATTTATTACTATTT	VIBHAR_06299
Vibrio parahaemolyticus RIMD 2210633
Position: -57 Score: 5.45153 Sequence: AAATGATAATAATTACAATTA Locus tag: VPA1435 Name: fhuA Funciton: TonB-dependent outer membrane receptor for iron siderophores Locus tag: VPA1436 Name: fhuC Funciton: Ferrichrome transport ATP-binding protein FhuC Locus tag: VPA1437 Name: fhuD Funciton: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3) Locus tag: VPA1438 Name: fhuB Funciton: Ferrichrome transport system permease protein FhuB
fhuA-fhuC-fhuD-fhuB	-57	5.5	AAATGATAATAATTACAATTA	VPA1435
Vibrio splendidus LGP32
Position: -49 Score: 5.55221 Sequence: AAATGAGATTTATTACTATTT Locus tag: VS_II0501 Name: fhuA Funciton: TonB-dependent outer membrane receptor for iron siderophores Locus tag: VS_II0502 Name: fhuD Funciton: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3) Locus tag: VS_II0503 Name: fhuB Funciton: Ferrichrome transport system permease protein FhuB
fhuA-fhuD-fhuB	-49	5.6	AAATGAGATTTATTACTATTT	VS_II0501