Orthologous regulated operons containing fhuD gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Photobacterium profundum SS9 | ||||
|
Position: -138
Score: 4.71786 Sequence: CAATGATAGTAGTTATCATTG
Locus tag: PBPRA1566
Name: fhuA Funciton: TonB-dependent outer membrane receptor for iron siderophores
Locus tag: PBPRA1565
Name: fhuC Funciton: Ferrichrome transport ATP-binding protein FhuC
Locus tag: PBPRA1564
Name: fhuD Funciton: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3) |
||||
| fhuA-fhuC-fhuD | -138 | 4.7 | CAATGATAGTAGTTATCATTG | PBPRA1566 |
| Vibrio cholerae O1 biovar eltor str. N16961 | ||||
|
Position: -54
Score: 5.23312 Sequence: AATTGAGAAAGATTCGCAATT
Position: -24
Score: 4.49305 Sequence: TAATTAAGATAATTATCACTA
Locus tag: VC0200
Name: fhuA Funciton: TonB-dependent outer membrane receptor for iron siderophores
Locus tag: VC0201
Name: fhuC Funciton: Ferrichrome transport ATP-binding protein FhuC
Locus tag: VC0202
Name: fhuD Funciton: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)
Locus tag: VC0203
Name: fhuB Funciton: Ferrichrome transport system permease protein FhuB |
||||
| fhuA-fhuC-fhuD-fhuB | -54 | 5.2 | AATTGAGAAAGATTCGCAATT | VC0200 |
| -24 | 4.5 | TAATTAAGATAATTATCACTA | ||
| Vibrio fischeri ES114 | ||||
|
Position: -55
Score: 4.72857 Sequence: GCAAGAGAATCATTCTCATTT
Locus tag: VF_A0784
Name: fhuA Funciton: TonB-dependent outer membrane receptor for iron siderophores
Locus tag: VF_A0783
Name: fhuC Funciton: Ferrichrome transport ATP-binding protein FhuC
Locus tag: VF_A0782
Name: fhuD Funciton: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3) |
||||
| fhuA-fhuC-fhuD | -55 | 4.7 | GCAAGAGAATCATTCTCATTT | VF_A0784 |
| Vibrio harveyi ATCC BAA-1116 | ||||
|
Position: -48
Score: 5.55221 Sequence: AAATGAGATTTATTACTATTT
Locus tag: VIBHAR_06299
Name: fhuA Funciton: TonB-dependent outer membrane receptor for iron siderophores
Locus tag: VIBHAR_06298
Name: fhuD Funciton: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)
Locus tag: VIBHAR_06297
Name: fhuB Funciton: Ferrichrome transport system permease protein FhuB |
||||
| fhuA-fhuD-fhuB | -48 | 5.6 | AAATGAGATTTATTACTATTT | VIBHAR_06299 |
| Vibrio parahaemolyticus RIMD 2210633 | ||||
|
Position: -57
Score: 5.45153 Sequence: AAATGATAATAATTACAATTA
Locus tag: VPA1435
Name: fhuA Funciton: TonB-dependent outer membrane receptor for iron siderophores
Locus tag: VPA1436
Name: fhuC Funciton: Ferrichrome transport ATP-binding protein FhuC
Locus tag: VPA1437
Name: fhuD Funciton: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)
Locus tag: VPA1438
Name: fhuB Funciton: Ferrichrome transport system permease protein FhuB |
||||
| fhuA-fhuC-fhuD-fhuB | -57 | 5.5 | AAATGATAATAATTACAATTA | VPA1435 |
| Vibrio splendidus LGP32 | ||||
|
Position: -49
Score: 5.55221 Sequence: AAATGAGATTTATTACTATTT
Locus tag: VS_II0501
Name: fhuA Funciton: TonB-dependent outer membrane receptor for iron siderophores
Locus tag: VS_II0502
Name: fhuD Funciton: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)
Locus tag: VS_II0503
Name: fhuB Funciton: Ferrichrome transport system permease protein FhuB |
||||
| fhuA-fhuD-fhuB | -49 | 5.6 | AAATGAGATTTATTACTATTT | VS_II0501 |