Orthologous regulated operons containing iutA gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio fischeri ES114 | ||||
|
Position: -62
Score: 4.46405 Sequence: GAATACGGATTTTTATCATTT
Position: -52
Score: 5.53394 Sequence: TAATGAGAATCATTAGCATTC
Locus tag: VF_A0161
Name: iucA Funciton: aerobactin siderophore biosynthesis protein IucA
Locus tag: VF_A0162
Name: iucB Funciton: aerobactin siderophore synthesis protein IucB
Locus tag: VF_A0163
Name: iucC Funciton: aerobactin siderophore biosynthesis protein IucC
Locus tag: VF_A0164
Name: iucD Funciton: aerobactin siderophore biosynthesis protein IucD
Locus tag: VF_A0165
Name: iutA Funciton: Aerobactin siderophore receptor IutA,TonB-dependent |
||||
| iucA-iucB-iucC-iucD-iutA | -62 | 4.5 | GAATACGGATTTTTATCATTT | VF_A0161 |
| -52 | 5.5 | TAATGAGAATCATTAGCATTC | ||
| Vibrio parahaemolyticus RIMD 2210633 | ||||
|
Position: -55
Score: 5.08835 Sequence: TATTGATAATAAGTATCATTG
Locus tag: VPA0979
Name: iutA Funciton: Aerobactin siderophore receptor IutA,TonB-dependent |
||||
| iutA | -55 | 5.1 | TATTGATAATAAGTATCATTG | VPA0979 |
| Vibrio shilonii AK1 | ||||
|
Position: -112
Score: 5.91248 Sequence: AAATAGTAATAATTATCATTT
Locus tag: VSAK1_20974
Name: iutA Funciton: Aerobactin siderophore receptor IutA,TonB-dependent |
||||
| iutA | -112 | 5.9 | AAATAGTAATAATTATCATTT | VSAK1_20974 |
| Vibrio splendidus LGP32 | ||||
|
Position: -298
Score: 5.36747 Sequence: CAATAATAATGATTCTTATTT
Position: -263
Score: 4.55501 Sequence: TAACGATAATACTTCGTACTT
Locus tag: VS_2116
Name: iutA Funciton: Aerobactin siderophore receptor IutA,TonB-dependent |
||||
| iutA | -298 | 5.4 | CAATAATAATGATTCTTATTT | VS_2116 |
| -263 | 4.6 | TAACGATAATACTTCGTACTT | ||
| Vibrio vulnificus CMCP6 | ||||
|
Position: -145
Score: 5.2775 Sequence: AAAAGAAAATAATTCGCATTT
Position: -97
Score: 5.27911 Sequence: CAATAATAACAATTCTTATTT
Locus tag: VV21016
Name: iutA Funciton: Aerobactin siderophore receptor IutA,TonB-dependent |
||||
| iutA | -145 | 5.3 | AAAAGAAAATAATTCGCATTT | VV21016 |
| -97 | 5.3 | CAATAATAACAATTCTTATTT | ||