Orthologous regulated operons containing iucB gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio fischeri ES114 | ||||
|
Position: -62
Score: 4.46405 Sequence: GAATACGGATTTTTATCATTT
Position: -52
Score: 5.53394 Sequence: TAATGAGAATCATTAGCATTC
Locus tag: VF_A0161
Name: iucA Funciton: aerobactin siderophore biosynthesis protein IucA
Locus tag: VF_A0162
Name: iucB Funciton: aerobactin siderophore synthesis protein IucB
Locus tag: VF_A0163
Name: iucC Funciton: aerobactin siderophore biosynthesis protein IucC
Locus tag: VF_A0164
Name: iucD Funciton: aerobactin siderophore biosynthesis protein IucD
Locus tag: VF_A0165
Name: iutA Funciton: Aerobactin siderophore receptor IutA,TonB-dependent |
||||
| iucA-iucB-iucC-iucD-iutA | -62 | 4.5 | GAATACGGATTTTTATCATTT | VF_A0161 |
| -52 | 5.5 | TAATGAGAATCATTAGCATTC | ||