Orthologous regulated operons containing VV1_2646 gene

Properties
Regulog:	Fur - Vibrionales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 447 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Vibrio angustum S14
Position: -60 Score: 4.72592 Sequence: AAATGAAAACACTTAACAATA Position: -41 Score: 4.79663 Sequence: TAATAGGAATCATTATCACTG Locus tag: VAS14_02953 Name: VV1_2646 Funciton: ABC-type multidrug transport system, ATPase and permease component Locus tag: VAS14_02958 Name: pqiA Funciton: Paraquat-inducible protein A Locus tag: VAS14_02963 Name: pqiB Funciton: Paraquat-inducible protein B
VV1_2646-pqiA-pqiB	-60	4.7	AAATGAAAACACTTAACAATA	VAS14_02953
	-41	4.8	TAATAGGAATCATTATCACTG
Vibrio fischeri ES114
Position: -26 Score: 4.43344 Sequence: AGATAATAATAGGAATCATTA Position: -20 Score: 5.22938 Sequence: TAATAGGAATCATTATCACTA Locus tag: VF_1277 Name: VV1_2646 Funciton: ABC-type multidrug transport system, ATPase and permease component Locus tag: VF_1276 Name: pqiA Funciton: Paraquat-inducible protein A Locus tag: VF_1275 Name: pqiB Funciton: Paraquat-inducible protein B
VV1_2646-pqiA-pqiB	-26	4.4	AGATAATAATAGGAATCATTA	VF_1277
	-20	5.2	TAATAGGAATCATTATCACTA
Vibrio harveyi ATCC BAA-1116
Position: -24 Score: 4.86752 Sequence: TAATAGGACTTATTCTCAATT Locus tag: VIBHAR_02349 Name: VV1_2646 Funciton: ABC-type multidrug transport system, ATPase and permease component
VV1_2646	-24	4.9	TAATAGGACTTATTCTCAATT	VIBHAR_02349
Vibrio parahaemolyticus RIMD 2210633
Position: -24 Score: 4.96165 Sequence: AAATAGGACTTATTCTCAATT Locus tag: VP1609 Name: VV1_2646 Funciton: ABC-type multidrug transport system, ATPase and permease component Locus tag: VP1610 Name: pqiA Funciton: Paraquat-inducible protein A Locus tag: VP1611 Name: pqiB Funciton: Paraquat-inducible protein B
VV1_2646-pqiA-pqiB	-24	5	AAATAGGACTTATTCTCAATT	VP1609
Vibrio salmonicida LFI1238
Position: -20 Score: 5.00535 Sequence: TAATAGGAATCATTCTCATTG Locus tag: VSAL_I1541 Name: VV1_2646 Funciton: ABC-type multidrug transport system, ATPase and permease component Locus tag: VSAL_I1540 Name: pqiA Funciton: Paraquat-inducible protein A Locus tag: VSAL_I1539 Name: pqiB Funciton: Paraquat-inducible protein B
VV1_2646-pqiA-pqiB	-20	5	TAATAGGAATCATTCTCATTG	VSAL_I1541
Vibrio shilonii AK1
Position: -23 Score: 4.6485 Sequence: TAATAGGAACTATTCTCAAAA Locus tag: VSAK1_05315 Name: VV1_2646 Funciton: ABC-type multidrug transport system, ATPase and permease component Locus tag: VSAK1_05320 Name: pqiA Funciton: Paraquat-inducible protein A Locus tag: VSAK1_05325 Name: pqiB Funciton: Paraquat-inducible protein B
VV1_2646-pqiA-pqiB	-23	4.6	TAATAGGAACTATTCTCAAAA	VSAK1_05315
Vibrio splendidus LGP32
Position: -23 Score: 5.01868 Sequence: AAATAGGACTTATTCTCATTA Locus tag: VS_1414 Name: VV1_2646 Funciton: ABC-type multidrug transport system, ATPase and permease component Locus tag: VS_1413 Name: pqiA Funciton: Paraquat-inducible protein A Locus tag: VS_1412 Name: pqiB Funciton: Paraquat-inducible protein B
VV1_2646-pqiA-pqiB	-23	5	AAATAGGACTTATTCTCATTA	VS_1414
Vibrio vulnificus CMCP6
Position: -23 Score: 5.01868 Sequence: AAATAGGACTTATTCTCATTA Locus tag: VV1_2646 Name: VV1_2646 Funciton: ABC-type multidrug transport system, ATPase and permease component Locus tag: VV1_2647 Name: pqiA Funciton: Paraquat-inducible protein A Locus tag: VV1_2648 Name: pqiB Funciton: Paraquat-inducible protein B
VV1_2646-pqiA-pqiB	-23	5	AAATAGGACTTATTCTCATTA	VV1_2646

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing VV1_2646 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --