Orthologous regulated operons containing VC0074 gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Photobacterium profundum SS9 | ||||
|
Position: -19
Score: 5.19297 Sequence: AACTGATAATGATTAGCGTTT
Locus tag: PBPRA3532
Name: VC0074 Funciton: conserved hypothetical protein |
||||
| VC0074 | -19 | 5.2 | AACTGATAATGATTAGCGTTT | PBPRA3532 |
| Vibrio angustum S14 | ||||
|
Position: -62
Score: 5.17428 Sequence: AATTACGAATCATTATCGTTT
Locus tag: VAS14_22809
Name: VC0074 Funciton: conserved hypothetical protein |
||||
| VC0074 | -62 | 5.2 | AATTACGAATCATTATCGTTT | VAS14_22809 |
| Vibrio cholerae O1 biovar eltor str. N16961 | ||||
|
Position: -29
Score: 4.46852 Sequence: GTCTGAGAATAATTCGTATTT
Locus tag: VC0074
Name: VC0074 Funciton: conserved hypothetical protein |
||||
| VC0074 | -29 | 4.5 | GTCTGAGAATAATTCGTATTT | VC0074 |
| Vibrio harveyi ATCC BAA-1116 | ||||
|
Position: -78
Score: 5.47783 Sequence: AACTAAGAATTATTATTATTA
Locus tag: VIBHAR_00530
Name: VC0074 Funciton: conserved hypothetical protein |
||||
| VC0074 | -78 | 5.5 | AACTAAGAATTATTATTATTA | VIBHAR_00530 |
| Vibrio parahaemolyticus RIMD 2210633 | ||||
|
Position: -66
Score: 5.57197 Sequence: AACTAAGAATTATTATTATTT
Locus tag: VP0074
Name: VC0074 Funciton: conserved hypothetical protein |
||||
| VC0074 | -66 | 5.6 | AACTAAGAATTATTATTATTT | VP0074 |
| Vibrio shilonii AK1 | ||||
|
Position: -47
Score: 4.52152 Sequence: AACTAAGAATCATTCCTGTTT
Locus tag: VSAK1_12905
Name: VC0074 Funciton: conserved hypothetical protein |
||||
| VC0074 | -47 | 4.5 | AACTAAGAATCATTCCTGTTT | VSAK1_12905 |
| Vibrio splendidus LGP32 | ||||
|
Position: -38
Score: 5.09213 Sequence: AACTAAGAATCATTATTATTC
Locus tag: VS_0088
Name: VC0074 Funciton: conserved hypothetical protein |
||||
| VC0074 | -38 | 5.1 | AACTAAGAATCATTATTATTC | VS_0088 |
| Vibrio vulnificus CMCP6 | ||||
|
Position: -66
Score: 5.18933 Sequence: AACTAAGAATTATTATTATTC
Locus tag: VV1_1113
Name: VC0074 Funciton: conserved hypothetical protein |
||||
| VC0074 | -66 | 5.2 | AACTAAGAATTATTATTATTC | VV1_1113 |