Orthologous regulated operons containing VC0877 gene
Regulog: | Fur - Vibrionales |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor (activator) |
Biological process: | Iron homeostasis |
Effector: | Iron ion, (Fe2+) |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Vibrio cholerae O1 biovar eltor str. N16961 | ||||
Position: 20
Score: 4.87186 Sequence: AATTAATAATTATTCTCAAGG
Locus tag: VC0877
Name: null Funciton: hypothetical protein
Locus tag: VC0876
Name: null Funciton: conserved hypothetical protein |
||||
VC0877-VC0876 | 20 | 4.9 | AATTAATAATTATTCTCAAGG | VC0877 |