Orthologous regulated operons containing VCA0067 gene

Properties
Regulog:	Fur - Vibrionales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 447 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Vibrio cholerae O1 biovar eltor str. N16961
Position: -76 Score: 5.73282 Sequence: AAATGATAATTGATCTTATTT Locus tag: VCA0063 Name: ptrB Funciton: Protease II (EC 3.4.21.83) Locus tag: VCA0064 Name: hutR Funciton: TonB-dependent heme receptor HutR Locus tag: VCA0065 Name: VCA0065 Funciton: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase Locus tag: VCA0066 Name: VCA0066 Funciton: Hypothetical protein in cluster with HutR, VCA0066 homolog Locus tag: VCA0067 Name: VCA0067 Funciton: Hypothetical protein in cluster with HutR, VCA0067 homolog
ptrB-hutR-VCA0065-VCA0066-VCA0067	-76	5.7	AAATGATAATTGATCTTATTT	VCA0063
Vibrio fischeri ES114
Position: -85 Score: 4.35258 Sequence: AAATGAAAATGATAATTGATC Position: -79 Score: 5.54283 Sequence: AAATGATAATTGATCTCATTC Locus tag: VF_A0333 Name: ptrB Funciton: Protease II (EC 3.4.21.83) Locus tag: VF_A0332 Name: hutR Funciton: TonB-dependent heme receptor HutR Locus tag: VF_A0331 Name: VCA0065 Funciton: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase Locus tag: VF_A0330 Name: VCA0066 Funciton: Hypothetical protein in cluster with HutR, VCA0066 homolog Locus tag: VF_A0329 Name: VCA0067 Funciton: Hypothetical protein in cluster with HutR, VCA0067 homolog
ptrB-hutR-VCA0065-VCA0066-VCA0067	-85	4.4	AAATGAAAATGATAATTGATC	VF_A0333
	-79	5.5	AAATGATAATTGATCTCATTC
Vibrio harveyi ATCC BAA-1116
Position: -80 Score: 5.92547 Sequence: AAATGATAATTGATCTCATTT Locus tag: VIBHAR_05127 Name: ptrB Funciton: Protease II (EC 3.4.21.83) Locus tag: VIBHAR_05128 Name: hutR Funciton: TonB-dependent heme receptor HutR Locus tag: VIBHAR_05129 Name: null Funciton: hypothetical protein Locus tag: VIBHAR_05130 Name: null Funciton: hypothetical protein Locus tag: VIBHAR_05131 Name: VCA0065 Funciton: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase Locus tag: VIBHAR_05132 Name: VCA0065 Funciton: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase Locus tag: VIBHAR_05133 Name: VCA0066 Funciton: Hypothetical protein in cluster with HutR, VCA0066 homolog Locus tag: VIBHAR_05134 Name: VCA0066 Funciton: Hypothetical protein in cluster with HutR, VCA0066 homolog Locus tag: VIBHAR_05135 Name: VCA0067 Funciton: Hypothetical protein in cluster with HutR, VCA0067 homolog
ptrB-hutR-VIBHAR_05129-VIBHAR_05130-VCA0065-VCA0065-VCA0066-VCA0066-VCA0067	-80	5.9	AAATGATAATTGATCTCATTT	VIBHAR_05127
Vibrio parahaemolyticus RIMD 2210633
Position: -79 Score: 5.92547 Sequence: AAATGATAATTGATCTCATTT Locus tag: VPA1467 Name: ptrB Funciton: Protease II (EC 3.4.21.83) Locus tag: VPA1466 Name: hutR Funciton: TonB-dependent heme receptor HutR Locus tag: VPA1465 Name: VCA0065 Funciton: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase Locus tag: VPA1464 Name: VCA0066 Funciton: Hypothetical protein in cluster with HutR, VCA0066 homolog Locus tag: VPA1463 Name: VCA0067 Funciton: Hypothetical protein in cluster with HutR, VCA0067 homolog
ptrB-hutR-VCA0065-VCA0066-VCA0067	-79	5.9	AAATGATAATTGATCTCATTT	VPA1467
Vibrio vulnificus CMCP6
Position: -155 Score: 5.77431 Sequence: AATTGATATCTATTCTCATTT Position: -103 Score: 5.3432 Sequence: AAATGATAATTGATGTTATTT Locus tag: VV21548 Name: ptrB Funciton: Protease II (EC 3.4.21.83) Locus tag: VV21549 Name: hutR Funciton: TonB-dependent heme receptor HutR Locus tag: VV21550 Name: VCA0065 Funciton: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase Locus tag: VV21551 Name: VCA0066 Funciton: Hypothetical protein in cluster with HutR, VCA0066 homolog Locus tag: VV21552 Name: VCA0067 Funciton: Hypothetical protein in cluster with HutR, VCA0067 homolog
ptrB-hutR-VCA0065-VCA0066-VCA0067	-155	5.8	AATTGATATCTATTCTCATTT	VV21548
	-103	5.3	AAATGATAATTGATGTTATTT