Orthologous regulated operons containing vctC gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio fischeri ES114 | ||||
|
Position: -65
Score: 5.56805 Sequence: TAATAATAACCATTTTCATTA
Position: -34
Score: 5.42656 Sequence: AAATACGAATAGTTATCACTT
Locus tag: VF_A0827
Name: vctP Funciton: ferric anguibactin-binding protein
Locus tag: VF_A0826
Name: vctD Funciton: ferric anguibactin transport system permease protein FatD
Locus tag: VF_A0825
Name: null Funciton: ferric anguibactin transport system permease protein FatC
Locus tag: VF_A0824
Name: vctC Funciton: ferric anguibactin transport ATP-binding protein
Locus tag: VF_A0823
Name: VIBHAR_06920 Funciton: Siderophore-interacting protein ViuB |
||||
| vctP-vctD-VF_A0825-vctC-VIBHAR_06920 | -65 | 5.6 | TAATAATAACCATTTTCATTA | VF_A0827 |
| -34 | 5.4 | AAATACGAATAGTTATCACTT | ||