Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing hmuT gene

Properties
Regulog: Fur - Vibrionales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 447 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -196
Score: 5.82117
Sequence: AAATGATAATCAATCTTATTT
Position: -141
Score: 5.44464
Sequence: AAATGATAATTGATATTATTC
Locus tag: PBPRA2103
Name: tonB-hmu
Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: PBPRA2104
Name: exbB-hmu
Funciton: TonB system transport protein ExbB involved in hemin uptake
Locus tag: PBPRA2105
Name: exbD-hmu
Funciton: TonB system transport protein ExbD involved in hemin uptake
Locus tag: PBPRA2106
Name: hmuT
Funciton: Hemin ABC transporter, periplasmic hemin-binding protein
Locus tag: PBPRA2107
Name: hmuU
Funciton: Hemin ABC transporter, permease component
Locus tag: PBPRA2108
Name: hmuV
Funciton: Hemin ABC transporter, ATP-binding subunit
tonB-hmu-exbB-hmu-exbD-hmu-hmuT-hmuU-hmuV -196 5.8 AAATGATAATCAATCTTATTT PBPRA2103
-141 5.4 AAATGATAATTGATATTATTC
Vibrio angustum S14
Position: -190
Score: 5.44464
Sequence: AAATGATAATTGATATTATTC
Locus tag: VAS14_03958
Name: tonB-hmu
Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: VAS14_03963
Name: exbB-hmu
Funciton: TonB system transport protein ExbB involved in hemin uptake
Locus tag: VAS14_03968
Name: exbD-hmu
Funciton: TonB system transport protein ExbD involved in hemin uptake
Locus tag: VAS14_03973
Name: hmuT
Funciton: Hemin ABC transporter, periplasmic hemin-binding protein
Locus tag: VAS14_03978
Name: hmuU
Funciton: Hemin ABC transporter, permease component
Locus tag: VAS14_03983
Name: hmuV
Funciton: Hemin ABC transporter, ATP-binding subunit
tonB-hmu-exbB-hmu-exbD-hmu-hmuT-hmuU-hmuV -190 5.4 AAATGATAATTGATATTATTC VAS14_03958
Vibrio cholerae O1 biovar eltor str. N16961
Position: -170
Score: 5.33368
Sequence: AATTGATAATTGCTATTATTA
Locus tag: VCA0910
Name: tonB-hmu
Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: VCA0911
Name: exbB-hmu
Funciton: TonB system transport protein ExbB involved in hemin uptake
Locus tag: VCA0912
Name: exbD-hmu
Funciton: TonB system transport protein ExbD involved in hemin uptake
Locus tag: VCA0913
Name: hmuT
Funciton: Hemin ABC transporter, periplasmic hemin-binding protein
Locus tag: VCA0914
Name: hmuU
Funciton: Hemin ABC transporter, permease component
Locus tag: VCA0915
Name: hmuV
Funciton: Hemin ABC transporter, ATP-binding subunit
tonB-hmu-exbB-hmu-exbD-hmu-hmuT-hmuU-hmuV -170 5.3 AATTGATAATTGCTATTATTA VCA0910
Vibrio fischeri ES114
Position: -65
Score: 5.68017
Sequence: AATTGATAATTGATCTCATTA
Locus tag: VF_1225
Name: tonB-hmu
Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: VF_1224
Name: exbB-hmu
Funciton: TonB system transport protein ExbB involved in hemin uptake
Locus tag: VF_1223
Name: exbD-hmu
Funciton: TonB system transport protein ExbD involved in hemin uptake
Locus tag: VF_1222
Name: hmuT
Funciton: Hemin ABC transporter, periplasmic hemin-binding protein
Locus tag: VF_1221
Name: hmuU
Funciton: Hemin ABC transporter, permease component
Locus tag: VF_1220
Name: hmuV
Funciton: Hemin ABC transporter, ATP-binding subunit
tonB-hmu-exbB-hmu-exbD-hmu-hmuT-hmuU-hmuV -65 5.7 AATTGATAATTGATCTCATTA VF_1225
Vibrio harveyi ATCC BAA-1116
Position: -79
Score: 5.58166
Sequence: AATTGATAATTGATCTTATTT
Position: -34
Score: 5.31682
Sequence: AGTTGATAATGATTAGCAATA
Locus tag: VIBHAR_05244
Name: tonB-hmu
Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: VIBHAR_05243
Name: exbB-hmu
Funciton: TonB system transport protein ExbB involved in hemin uptake
Locus tag: VIBHAR_05242
Name: exbD-hmu
Funciton: TonB system transport protein ExbD involved in hemin uptake
Locus tag: VIBHAR_05241
Name: hmuT
Funciton: Hemin ABC transporter, periplasmic hemin-binding protein
Locus tag: VIBHAR_05240
Name: hmuU
Funciton: Hemin ABC transporter, permease component
Locus tag: VIBHAR_05239
Name: hmuV
Funciton: Hemin ABC transporter, ATP-binding subunit
tonB-hmu-exbB-hmu-exbD-hmu-hmuT-hmuU-hmuV -79 5.6 AATTGATAATTGATCTTATTT VIBHAR_05244
-34 5.3 AGTTGATAATGATTAGCAATA
Vibrio parahaemolyticus RIMD 2210633
Position: -74
Score: 5.58166
Sequence: AATTGATAATTGATCTTATTT
Locus tag: VPA0426
Name: tonB-hmu
Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: VPA0425
Name: exbB-hmu
Funciton: TonB system transport protein ExbB involved in hemin uptake
Locus tag: VPA0424
Name: exbD-hmu
Funciton: TonB system transport protein ExbD involved in hemin uptake
Locus tag: VPA0423
Name: hmuT
Funciton: Hemin ABC transporter, periplasmic hemin-binding protein
Locus tag: VPA0422
Name: hmuU
Funciton: Hemin ABC transporter, permease component
Locus tag: VPA0421
Name: hmuV
Funciton: Hemin ABC transporter, ATP-binding subunit
tonB-hmu-exbB-hmu-exbD-hmu-hmuT-hmuU-hmuV -74 5.6 AATTGATAATTGATCTTATTT VPA0426
Vibrio shilonii AK1
Position: -78
Score: 5.58166
Sequence: AATTGATAATTGATCTTATTT
Locus tag: VSAK1_22229
Name: tonB-hmu
Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: VSAK1_22224
Name: tonB-hmu
Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: VSAK1_22219
Name: exbB-hmu
Funciton: TonB system transport protein ExbB involved in hemin uptake
Locus tag: VSAK1_22214
Name: exbD-hmu
Funciton: TonB system transport protein ExbD involved in hemin uptake
Locus tag: VSAK1_22209
Name: hmuT
Funciton: Hemin ABC transporter, periplasmic hemin-binding protein
Locus tag: VSAK1_22204
Name: hmuU
Funciton: Hemin ABC transporter, permease component
Locus tag: VSAK1_22199
Name: hmuV
Funciton: Hemin ABC transporter, ATP-binding subunit
tonB-hmu-tonB-hmu-exbB-hmu-exbD-hmu-hmuT-hmuU-hmuV -78 5.6 AATTGATAATTGATCTTATTT VSAK1_22229
Vibrio splendidus LGP32
Position: -67
Score: 5.58166
Sequence: AATTGATAATTGATCTTATTT
Locus tag: VS_II0289
Name: tonB-hmu
Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: VS_II0288
Name: exbB-hmu
Funciton: TonB system transport protein ExbB involved in hemin uptake
Locus tag: VS_II0287
Name: exbD-hmu
Funciton: TonB system transport protein ExbD involved in hemin uptake
Locus tag: VS_II0286
Name: hmuT
Funciton: Hemin ABC transporter, periplasmic hemin-binding protein
Locus tag: VS_II0285
Name: hmuU
Funciton: Hemin ABC transporter, permease component
Locus tag: VS_II0284
Name: hmuV
Funciton: Hemin ABC transporter, ATP-binding subunit
tonB-hmu-exbB-hmu-exbD-hmu-hmuT-hmuU-hmuV -67 5.6 AATTGATAATTGATCTTATTT VS_II0289
Vibrio vulnificus CMCP6
Position: -115
Score: 5.58166
Sequence: AATTGATAATTGATCTTATTT
Locus tag: VV21614
Name: tonB-hmu
Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: VV21613
Name: exbB-hmu
Funciton: TonB system transport protein ExbB involved in hemin uptake
Locus tag: VV21612
Name: exbD-hmu
Funciton: TonB system transport protein ExbD involved in hemin uptake
Locus tag: VV21611
Name: hmuT
Funciton: Hemin ABC transporter, periplasmic hemin-binding protein
Locus tag: VV21610
Name: hmuU
Funciton: Hemin ABC transporter, permease component
Locus tag: VV21609
Name: hmuV
Funciton: Hemin ABC transporter, ATP-binding subunit
tonB-hmu-exbB-hmu-exbD-hmu-hmuT-hmuU-hmuV -115 5.6 AATTGATAATTGATCTTATTT VV21614
© 2009-2020 RegPrecise