Orthologous regulated operons containing exbD-hmu gene
Regulog: | Fur - Vibrionales |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor (activator) |
Biological process: | Iron homeostasis |
Effector: | Iron ion, (Fe2+) |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Photobacterium profundum SS9 | ||||
Position: -196
Score: 5.82117 Sequence: AAATGATAATCAATCTTATTT
Position: -141
Score: 5.44464 Sequence: AAATGATAATTGATATTATTC
Locus tag: PBPRA2103
Name: tonB-hmu Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: PBPRA2104
Name: exbB-hmu Funciton: TonB system transport protein ExbB involved in hemin uptake
Locus tag: PBPRA2105
Name: exbD-hmu Funciton: TonB system transport protein ExbD involved in hemin uptake
Locus tag: PBPRA2106
Name: hmuT Funciton: Hemin ABC transporter, periplasmic hemin-binding protein
Locus tag: PBPRA2107
Name: hmuU Funciton: Hemin ABC transporter, permease component
Locus tag: PBPRA2108
Name: hmuV Funciton: Hemin ABC transporter, ATP-binding subunit |
||||
tonB-hmu-exbB-hmu-exbD-hmu-hmuT-hmuU-hmuV | -196 | 5.8 | AAATGATAATCAATCTTATTT | PBPRA2103 |
-141 | 5.4 | AAATGATAATTGATATTATTC | ||
Vibrio angustum S14 | ||||
Position: -190
Score: 5.44464 Sequence: AAATGATAATTGATATTATTC
Locus tag: VAS14_03958
Name: tonB-hmu Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: VAS14_03963
Name: exbB-hmu Funciton: TonB system transport protein ExbB involved in hemin uptake
Locus tag: VAS14_03968
Name: exbD-hmu Funciton: TonB system transport protein ExbD involved in hemin uptake
Locus tag: VAS14_03973
Name: hmuT Funciton: Hemin ABC transporter, periplasmic hemin-binding protein
Locus tag: VAS14_03978
Name: hmuU Funciton: Hemin ABC transporter, permease component
Locus tag: VAS14_03983
Name: hmuV Funciton: Hemin ABC transporter, ATP-binding subunit |
||||
tonB-hmu-exbB-hmu-exbD-hmu-hmuT-hmuU-hmuV | -190 | 5.4 | AAATGATAATTGATATTATTC | VAS14_03958 |
Vibrio cholerae O1 biovar eltor str. N16961 | ||||
Position: -170
Score: 5.33368 Sequence: AATTGATAATTGCTATTATTA
Locus tag: VCA0910
Name: tonB-hmu Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: VCA0911
Name: exbB-hmu Funciton: TonB system transport protein ExbB involved in hemin uptake
Locus tag: VCA0912
Name: exbD-hmu Funciton: TonB system transport protein ExbD involved in hemin uptake
Locus tag: VCA0913
Name: hmuT Funciton: Hemin ABC transporter, periplasmic hemin-binding protein
Locus tag: VCA0914
Name: hmuU Funciton: Hemin ABC transporter, permease component
Locus tag: VCA0915
Name: hmuV Funciton: Hemin ABC transporter, ATP-binding subunit |
||||
tonB-hmu-exbB-hmu-exbD-hmu-hmuT-hmuU-hmuV | -170 | 5.3 | AATTGATAATTGCTATTATTA | VCA0910 |
Vibrio fischeri ES114 | ||||
Position: -65
Score: 5.68017 Sequence: AATTGATAATTGATCTCATTA
Locus tag: VF_1225
Name: tonB-hmu Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: VF_1224
Name: exbB-hmu Funciton: TonB system transport protein ExbB involved in hemin uptake
Locus tag: VF_1223
Name: exbD-hmu Funciton: TonB system transport protein ExbD involved in hemin uptake
Locus tag: VF_1222
Name: hmuT Funciton: Hemin ABC transporter, periplasmic hemin-binding protein
Locus tag: VF_1221
Name: hmuU Funciton: Hemin ABC transporter, permease component
Locus tag: VF_1220
Name: hmuV Funciton: Hemin ABC transporter, ATP-binding subunit |
||||
tonB-hmu-exbB-hmu-exbD-hmu-hmuT-hmuU-hmuV | -65 | 5.7 | AATTGATAATTGATCTCATTA | VF_1225 |
Vibrio harveyi ATCC BAA-1116 | ||||
Position: -79
Score: 5.58166 Sequence: AATTGATAATTGATCTTATTT
Position: -34
Score: 5.31682 Sequence: AGTTGATAATGATTAGCAATA
Locus tag: VIBHAR_05244
Name: tonB-hmu Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: VIBHAR_05243
Name: exbB-hmu Funciton: TonB system transport protein ExbB involved in hemin uptake
Locus tag: VIBHAR_05242
Name: exbD-hmu Funciton: TonB system transport protein ExbD involved in hemin uptake
Locus tag: VIBHAR_05241
Name: hmuT Funciton: Hemin ABC transporter, periplasmic hemin-binding protein
Locus tag: VIBHAR_05240
Name: hmuU Funciton: Hemin ABC transporter, permease component
Locus tag: VIBHAR_05239
Name: hmuV Funciton: Hemin ABC transporter, ATP-binding subunit |
||||
tonB-hmu-exbB-hmu-exbD-hmu-hmuT-hmuU-hmuV | -79 | 5.6 | AATTGATAATTGATCTTATTT | VIBHAR_05244 |
-34 | 5.3 | AGTTGATAATGATTAGCAATA | ||
Vibrio parahaemolyticus RIMD 2210633 | ||||
Position: -74
Score: 5.58166 Sequence: AATTGATAATTGATCTTATTT
Locus tag: VPA0426
Name: tonB-hmu Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: VPA0425
Name: exbB-hmu Funciton: TonB system transport protein ExbB involved in hemin uptake
Locus tag: VPA0424
Name: exbD-hmu Funciton: TonB system transport protein ExbD involved in hemin uptake
Locus tag: VPA0423
Name: hmuT Funciton: Hemin ABC transporter, periplasmic hemin-binding protein
Locus tag: VPA0422
Name: hmuU Funciton: Hemin ABC transporter, permease component
Locus tag: VPA0421
Name: hmuV Funciton: Hemin ABC transporter, ATP-binding subunit |
||||
tonB-hmu-exbB-hmu-exbD-hmu-hmuT-hmuU-hmuV | -74 | 5.6 | AATTGATAATTGATCTTATTT | VPA0426 |
Vibrio shilonii AK1 | ||||
Position: -78
Score: 5.58166 Sequence: AATTGATAATTGATCTTATTT
Locus tag: VSAK1_22229
Name: tonB-hmu Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: VSAK1_22224
Name: tonB-hmu Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: VSAK1_22219
Name: exbB-hmu Funciton: TonB system transport protein ExbB involved in hemin uptake
Locus tag: VSAK1_22214
Name: exbD-hmu Funciton: TonB system transport protein ExbD involved in hemin uptake
Locus tag: VSAK1_22209
Name: hmuT Funciton: Hemin ABC transporter, periplasmic hemin-binding protein
Locus tag: VSAK1_22204
Name: hmuU Funciton: Hemin ABC transporter, permease component
Locus tag: VSAK1_22199
Name: hmuV Funciton: Hemin ABC transporter, ATP-binding subunit |
||||
tonB-hmu-tonB-hmu-exbB-hmu-exbD-hmu-hmuT-hmuU-hmuV | -78 | 5.6 | AATTGATAATTGATCTTATTT | VSAK1_22229 |
Vibrio splendidus LGP32 | ||||
Position: -67
Score: 5.58166 Sequence: AATTGATAATTGATCTTATTT
Locus tag: VS_II0289
Name: tonB-hmu Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: VS_II0288
Name: exbB-hmu Funciton: TonB system transport protein ExbB involved in hemin uptake
Locus tag: VS_II0287
Name: exbD-hmu Funciton: TonB system transport protein ExbD involved in hemin uptake
Locus tag: VS_II0286
Name: hmuT Funciton: Hemin ABC transporter, periplasmic hemin-binding protein
Locus tag: VS_II0285
Name: hmuU Funciton: Hemin ABC transporter, permease component
Locus tag: VS_II0284
Name: hmuV Funciton: Hemin ABC transporter, ATP-binding subunit |
||||
tonB-hmu-exbB-hmu-exbD-hmu-hmuT-hmuU-hmuV | -67 | 5.6 | AATTGATAATTGATCTTATTT | VS_II0289 |
Vibrio vulnificus CMCP6 | ||||
Position: -115
Score: 5.58166 Sequence: AATTGATAATTGATCTTATTT
Locus tag: VV21614
Name: tonB-hmu Funciton: Periplasmic protein TonB involved in hemin uptake
Locus tag: VV21613
Name: exbB-hmu Funciton: TonB system transport protein ExbB involved in hemin uptake
Locus tag: VV21612
Name: exbD-hmu Funciton: TonB system transport protein ExbD involved in hemin uptake
Locus tag: VV21611
Name: hmuT Funciton: Hemin ABC transporter, periplasmic hemin-binding protein
Locus tag: VV21610
Name: hmuU Funciton: Hemin ABC transporter, permease component
Locus tag: VV21609
Name: hmuV Funciton: Hemin ABC transporter, ATP-binding subunit |
||||
tonB-hmu-exbB-hmu-exbD-hmu-hmuT-hmuU-hmuV | -115 | 5.6 | AATTGATAATTGATCTTATTT | VV21614 |