Orthologous regulated operons containing VC1543 gene
Regulog: | Fur - Vibrionales |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor (activator) |
Biological process: | Iron homeostasis |
Effector: | Iron ion, (Fe2+) |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Photobacterium profundum SS9 | ||||
Position: -98
Score: 5.62308 Sequence: AAATGAGATTCATTTTCAATT
Position: -20
Score: 4.44474 Sequence: AAATACTATTGATGAGCAATA
Locus tag: PBPRB0694
Name: PF11932 Funciton: hypothetical protein
Locus tag: PBPRB0695
Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: PBPRB0696
Name: exbB2 Funciton: TonB system transport protein ExbB2
Locus tag: PBPRB0697
Name: exbD2 Funciton: TonB system transport protein ExbD2
Locus tag: PBPRB0698
Name: tonB Funciton: Periplasmic protein TonB
Locus tag: PBPRB0699
Name: VC1543 Funciton: TPR domain protein, putative component of TonB system |
||||
PF11932-exbB1-exbB2-exbD2-tonB-VC1543 | -98 | 5.6 | AAATGAGATTCATTTTCAATT | PBPRB0694 |
-20 | 4.4 | AAATACTATTGATGAGCAATA | ||
Vibrio angustum S14 | ||||
Position: -189
Score: 5.51921 Sequence: AAATGGTAATGGTTATCACTT
Locus tag: VAS14_12509
Name: fhuE Funciton: Putative ferrichrome-iron receptor
Locus tag: VAS14_12504
Name: PF11932 Funciton: hypothetical protein
Locus tag: VAS14_12499
Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: VAS14_12494
Name: exbB2 Funciton: TonB system transport protein ExbB2
Locus tag: VAS14_12489
Name: exbD2 Funciton: TonB system transport protein ExbD2
Locus tag: VAS14_12484
Name: tonB Funciton: Periplasmic protein TonB
Locus tag: VAS14_12479
Name: VC1543 Funciton: TPR domain protein, putative component of TonB system |
||||
fhuE-PF11932-exbB1-exbB2-exbD2-tonB-VC1543 | -189 | 5.5 | AAATGGTAATGGTTATCACTT | VAS14_12509 |
Vibrio cholerae O1 biovar eltor str. N16961 | ||||
Position: -58
Score: 4.76526 Sequence: TAATGAGAGCGTTTCTCAATA
Locus tag: VC1548
Name: PF11932 Funciton: hypothetical protein
Locus tag: VC1547
Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: VC1546
Name: exbB2 Funciton: TonB system transport protein ExbB2
Locus tag: VC1544
Name: tonB Funciton: Periplasmic protein TonB
Locus tag: VC1543
Name: VC1543 Funciton: TPR domain protein, putative component of TonB system |
||||
PF11932-exbB1-exbB2-tonB-VC1543 | -58 | 4.8 | TAATGAGAGCGTTTCTCAATA | VC1548 |
Vibrio fischeri ES114 | ||||
Position: -83
Score: 5.91957 Sequence: AAATGGTAACAATTATCATTT
Locus tag: VF_A0191
Name: fhuE Funciton: Putative ferrichrome-iron receptor
Locus tag: VF_A0192
Name: PF11932 Funciton: hypothetical protein
Locus tag: VF_A0193
Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: VF_A0194
Name: exbB2 Funciton: TonB system transport protein ExbB2
Locus tag: VF_A0195
Name: exbD2 Funciton: TonB system transport protein ExbD2
Locus tag: VF_A0196
Name: tonB Funciton: Periplasmic protein TonB
Locus tag: VF_A0197
Name: VC1543 Funciton: TPR domain protein, putative component of TonB system |
||||
fhuE-PF11932-exbB1-exbB2-exbD2-tonB-VC1543 | -83 | 5.9 | AAATGGTAACAATTATCATTT | VF_A0191 |
Vibrio harveyi ATCC BAA-1116 | ||||
Position: -97
Score: 5.4355 Sequence: AAATGGTAATAGTTGTCATTT
Locus tag: VIBHAR_06761
Name: fhuE Funciton: Putative ferrichrome-iron receptor
Locus tag: VIBHAR_06760
Name: PF11932 Funciton: hypothetical protein
Locus tag: VIBHAR_06759
Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: VIBHAR_06758
Name: exbB2 Funciton: TonB system transport protein ExbB2
Locus tag: VIBHAR_06757
Name: exbD2 Funciton: TonB system transport protein ExbD2
Locus tag: VIBHAR_06756
Name: tonB Funciton: Periplasmic protein TonB
Locus tag: VIBHAR_06755
Name: VC1543 Funciton: TPR domain protein, putative component of TonB system |
||||
fhuE-PF11932-exbB1-exbB2-exbD2-tonB-VC1543 | -97 | 5.4 | AAATGGTAATAGTTGTCATTT | VIBHAR_06761 |
Vibrio parahaemolyticus RIMD 2210633 | ||||
Position: -98
Score: 5.33163 Sequence: AAATGGTAATACTTATCACTT
Locus tag: VPA0150
Name: fhuE Funciton: Putative ferrichrome-iron receptor
Locus tag: VPA0151
Name: PF11932 Funciton: hypothetical protein
Locus tag: VPA0152
Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: VPA0153
Name: exbB2 Funciton: TonB system transport protein ExbB2
Locus tag: VPA0154
Name: exbD2 Funciton: TonB system transport protein ExbD2
Locus tag: VPA0155
Name: tonB Funciton: Periplasmic protein TonB
Locus tag: VPA0156
Name: VC1543 Funciton: TPR domain protein, putative component of TonB system |
||||
fhuE-PF11932-exbB1-exbB2-exbD2-tonB-VC1543 | -98 | 5.3 | AAATGGTAATACTTATCACTT | VPA0150 |
Vibrio salmonicida LFI1238 | ||||
Position: -82
Score: 5.75632 Sequence: AAATAAAAACGATTATCATTT
Locus tag: VSAL_II0110
Name: fhuE Funciton: Putative ferrichrome-iron receptor
Locus tag: VSAL_II0111
Name: PF11932 Funciton: hypothetical protein
Locus tag: VSAL_II0112
Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: VSAL_II0113
Name: exbB2 Funciton: TonB system transport protein ExbB2
Locus tag: VSAL_II0114
Name: exbD2 Funciton: TonB system transport protein ExbD2
Locus tag: VSAL_II0115
Name: tonB Funciton: Periplasmic protein TonB
Locus tag: VSAL_II0116
Name: VC1543 Funciton: TPR domain protein, putative component of TonB system |
||||
fhuE-PF11932-exbB1-exbB2-exbD2-tonB-VC1543 | -82 | 5.8 | AAATAAAAACGATTATCATTT | VSAL_II0110 |
Vibrio shilonii AK1 | ||||
Position: -225
Score: 5.3043 Sequence: AAATGATAACTCATATCAATA
Locus tag: VSAK1_26760
Name: PF11932 Funciton: hypothetical protein
Locus tag: VSAK1_26755
Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: VSAK1_26750
Name: exbB2 Funciton: TonB system transport protein ExbB2
Locus tag: VSAK1_26745
Name: exbD2 Funciton: TonB system transport protein ExbD2
Locus tag: VSAK1_26740
Name: tonB Funciton: Periplasmic protein TonB
Locus tag: VSAK1_26735
Name: VC1543 Funciton: TPR domain protein, putative component of TonB system |
||||
PF11932-exbB1-exbB2-exbD2-tonB-VC1543 | -225 | 5.3 | AAATGATAACTCATATCAATA | VSAK1_26760 |
Vibrio splendidus LGP32 | ||||
Position: -61
Score: 4.85912 Sequence: TAATGAGACTGCTTATCAATA
Locus tag: VS_II0678
Name: PF11932 Funciton: hypothetical protein
Locus tag: VS_II0679
Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: VS_II0680
Name: exbB2 Funciton: TonB system transport protein ExbB2
Locus tag: VS_II0681
Name: exbD2 Funciton: TonB system transport protein ExbD2
Locus tag: VS_II0682
Name: tonB Funciton: Periplasmic protein TonB
Locus tag: VS_II0683
Name: VC1543 Funciton: TPR domain protein, putative component of TonB system |
||||
PF11932-exbB1-exbB2-exbD2-tonB-VC1543 | -61 | 4.9 | TAATGAGACTGCTTATCAATA | VS_II0678 |
Vibrio vulnificus CMCP6 | ||||
Position: -58
Score: 5.74796 Sequence: TAATGCGAATAAATATCATTT
Locus tag: VV20364
Name: PF11932 Funciton: hypothetical protein
Locus tag: VV20363
Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: VV20362
Name: exbB2 Funciton: TonB system transport protein ExbB2
Locus tag: VV20361
Name: exbD2 Funciton: TonB system transport protein ExbD2
Locus tag: VV20360
Name: tonB Funciton: Periplasmic protein TonB
Locus tag: VV20359
Name: VC1543 Funciton: TPR domain protein, putative component of TonB system |
||||
PF11932-exbB1-exbB2-exbD2-tonB-VC1543 | -58 | 5.7 | TAATGCGAATAAATATCATTT | VV20364 |