Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing VC1543 gene

Properties
Regulog: Fur - Vibrionales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 447 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -98
Score: 5.62308
Sequence: AAATGAGATTCATTTTCAATT
Position: -20
Score: 4.44474
Sequence: AAATACTATTGATGAGCAATA
Locus tag: PBPRB0694
Name: PF11932
Funciton: hypothetical protein
Locus tag: PBPRB0695
Name: exbB1
Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: PBPRB0696
Name: exbB2
Funciton: TonB system transport protein ExbB2
Locus tag: PBPRB0697
Name: exbD2
Funciton: TonB system transport protein ExbD2
Locus tag: PBPRB0698
Name: tonB
Funciton: Periplasmic protein TonB
Locus tag: PBPRB0699
Name: VC1543
Funciton: TPR domain protein, putative component of TonB system
PF11932-exbB1-exbB2-exbD2-tonB-VC1543 -98 5.6 AAATGAGATTCATTTTCAATT PBPRB0694
-20 4.4 AAATACTATTGATGAGCAATA
Vibrio angustum S14
Position: -189
Score: 5.51921
Sequence: AAATGGTAATGGTTATCACTT
Locus tag: VAS14_12509
Name: fhuE
Funciton: Putative ferrichrome-iron receptor
Locus tag: VAS14_12504
Name: PF11932
Funciton: hypothetical protein
Locus tag: VAS14_12499
Name: exbB1
Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: VAS14_12494
Name: exbB2
Funciton: TonB system transport protein ExbB2
Locus tag: VAS14_12489
Name: exbD2
Funciton: TonB system transport protein ExbD2
Locus tag: VAS14_12484
Name: tonB
Funciton: Periplasmic protein TonB
Locus tag: VAS14_12479
Name: VC1543
Funciton: TPR domain protein, putative component of TonB system
fhuE-PF11932-exbB1-exbB2-exbD2-tonB-VC1543 -189 5.5 AAATGGTAATGGTTATCACTT VAS14_12509
Vibrio cholerae O1 biovar eltor str. N16961
Position: -58
Score: 4.76526
Sequence: TAATGAGAGCGTTTCTCAATA
Locus tag: VC1548
Name: PF11932
Funciton: hypothetical protein
Locus tag: VC1547
Name: exbB1
Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: VC1546
Name: exbB2
Funciton: TonB system transport protein ExbB2
Locus tag: VC1544
Name: tonB
Funciton: Periplasmic protein TonB
Locus tag: VC1543
Name: VC1543
Funciton: TPR domain protein, putative component of TonB system
PF11932-exbB1-exbB2-tonB-VC1543 -58 4.8 TAATGAGAGCGTTTCTCAATA VC1548
Vibrio fischeri ES114
Position: -83
Score: 5.91957
Sequence: AAATGGTAACAATTATCATTT
Locus tag: VF_A0191
Name: fhuE
Funciton: Putative ferrichrome-iron receptor
Locus tag: VF_A0192
Name: PF11932
Funciton: hypothetical protein
Locus tag: VF_A0193
Name: exbB1
Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: VF_A0194
Name: exbB2
Funciton: TonB system transport protein ExbB2
Locus tag: VF_A0195
Name: exbD2
Funciton: TonB system transport protein ExbD2
Locus tag: VF_A0196
Name: tonB
Funciton: Periplasmic protein TonB
Locus tag: VF_A0197
Name: VC1543
Funciton: TPR domain protein, putative component of TonB system
fhuE-PF11932-exbB1-exbB2-exbD2-tonB-VC1543 -83 5.9 AAATGGTAACAATTATCATTT VF_A0191
Vibrio harveyi ATCC BAA-1116
Position: -97
Score: 5.4355
Sequence: AAATGGTAATAGTTGTCATTT
Locus tag: VIBHAR_06761
Name: fhuE
Funciton: Putative ferrichrome-iron receptor
Locus tag: VIBHAR_06760
Name: PF11932
Funciton: hypothetical protein
Locus tag: VIBHAR_06759
Name: exbB1
Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: VIBHAR_06758
Name: exbB2
Funciton: TonB system transport protein ExbB2
Locus tag: VIBHAR_06757
Name: exbD2
Funciton: TonB system transport protein ExbD2
Locus tag: VIBHAR_06756
Name: tonB
Funciton: Periplasmic protein TonB
Locus tag: VIBHAR_06755
Name: VC1543
Funciton: TPR domain protein, putative component of TonB system
fhuE-PF11932-exbB1-exbB2-exbD2-tonB-VC1543 -97 5.4 AAATGGTAATAGTTGTCATTT VIBHAR_06761
Vibrio parahaemolyticus RIMD 2210633
Position: -98
Score: 5.33163
Sequence: AAATGGTAATACTTATCACTT
Locus tag: VPA0150
Name: fhuE
Funciton: Putative ferrichrome-iron receptor
Locus tag: VPA0151
Name: PF11932
Funciton: hypothetical protein
Locus tag: VPA0152
Name: exbB1
Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: VPA0153
Name: exbB2
Funciton: TonB system transport protein ExbB2
Locus tag: VPA0154
Name: exbD2
Funciton: TonB system transport protein ExbD2
Locus tag: VPA0155
Name: tonB
Funciton: Periplasmic protein TonB
Locus tag: VPA0156
Name: VC1543
Funciton: TPR domain protein, putative component of TonB system
fhuE-PF11932-exbB1-exbB2-exbD2-tonB-VC1543 -98 5.3 AAATGGTAATACTTATCACTT VPA0150
Vibrio salmonicida LFI1238
Position: -82
Score: 5.75632
Sequence: AAATAAAAACGATTATCATTT
Locus tag: VSAL_II0110
Name: fhuE
Funciton: Putative ferrichrome-iron receptor
Locus tag: VSAL_II0111
Name: PF11932
Funciton: hypothetical protein
Locus tag: VSAL_II0112
Name: exbB1
Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: VSAL_II0113
Name: exbB2
Funciton: TonB system transport protein ExbB2
Locus tag: VSAL_II0114
Name: exbD2
Funciton: TonB system transport protein ExbD2
Locus tag: VSAL_II0115
Name: tonB
Funciton: Periplasmic protein TonB
Locus tag: VSAL_II0116
Name: VC1543
Funciton: TPR domain protein, putative component of TonB system
fhuE-PF11932-exbB1-exbB2-exbD2-tonB-VC1543 -82 5.8 AAATAAAAACGATTATCATTT VSAL_II0110
Vibrio shilonii AK1
Position: -225
Score: 5.3043
Sequence: AAATGATAACTCATATCAATA
Locus tag: VSAK1_26760
Name: PF11932
Funciton: hypothetical protein
Locus tag: VSAK1_26755
Name: exbB1
Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: VSAK1_26750
Name: exbB2
Funciton: TonB system transport protein ExbB2
Locus tag: VSAK1_26745
Name: exbD2
Funciton: TonB system transport protein ExbD2
Locus tag: VSAK1_26740
Name: tonB
Funciton: Periplasmic protein TonB
Locus tag: VSAK1_26735
Name: VC1543
Funciton: TPR domain protein, putative component of TonB system
PF11932-exbB1-exbB2-exbD2-tonB-VC1543 -225 5.3 AAATGATAACTCATATCAATA VSAK1_26760
Vibrio splendidus LGP32
Position: -61
Score: 4.85912
Sequence: TAATGAGACTGCTTATCAATA
Locus tag: VS_II0678
Name: PF11932
Funciton: hypothetical protein
Locus tag: VS_II0679
Name: exbB1
Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: VS_II0680
Name: exbB2
Funciton: TonB system transport protein ExbB2
Locus tag: VS_II0681
Name: exbD2
Funciton: TonB system transport protein ExbD2
Locus tag: VS_II0682
Name: tonB
Funciton: Periplasmic protein TonB
Locus tag: VS_II0683
Name: VC1543
Funciton: TPR domain protein, putative component of TonB system
PF11932-exbB1-exbB2-exbD2-tonB-VC1543 -61 4.9 TAATGAGACTGCTTATCAATA VS_II0678
Vibrio vulnificus CMCP6
Position: -58
Score: 5.74796
Sequence: TAATGCGAATAAATATCATTT
Locus tag: VV20364
Name: PF11932
Funciton: hypothetical protein
Locus tag: VV20363
Name: exbB1
Funciton: Biopolymer transport protein ExbB-related protein
Locus tag: VV20362
Name: exbB2
Funciton: TonB system transport protein ExbB2
Locus tag: VV20361
Name: exbD2
Funciton: TonB system transport protein ExbD2
Locus tag: VV20360
Name: tonB
Funciton: Periplasmic protein TonB
Locus tag: VV20359
Name: VC1543
Funciton: TPR domain protein, putative component of TonB system
PF11932-exbB1-exbB2-exbD2-tonB-VC1543 -58 5.7 TAATGCGAATAAATATCATTT VV20364