Orthologous regulated operons containing fhuE gene

Properties
Regulog:	Fur - Vibrionales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 447 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -160 Score: 5.71365 Sequence: AAATGCTAACAATTATCACTT Locus tag: PBPRB1222 Name: fhuE Funciton: Putative ferrichrome-iron receptor
fhuE	-160	5.7	AAATGCTAACAATTATCACTT	PBPRB1222
Vibrio angustum S14
Position: -189 Score: 5.51921 Sequence: AAATGGTAATGGTTATCACTT Locus tag: VAS14_12509 Name: fhuE Funciton: Putative ferrichrome-iron receptor Locus tag: VAS14_12504 Name: PF11932 Funciton: hypothetical protein Locus tag: VAS14_12499 Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein Locus tag: VAS14_12494 Name: exbB2 Funciton: TonB system transport protein ExbB2 Locus tag: VAS14_12489 Name: exbD2 Funciton: TonB system transport protein ExbD2 Locus tag: VAS14_12484 Name: tonB Funciton: Periplasmic protein TonB Locus tag: VAS14_12479 Name: VC1543 Funciton: TPR domain protein, putative component of TonB system
fhuE-PF11932-exbB1-exbB2-exbD2-tonB-VC1543	-189	5.5	AAATGGTAATGGTTATCACTT	VAS14_12509
Vibrio fischeri ES114
Position: -83 Score: 5.91957 Sequence: AAATGGTAACAATTATCATTT Locus tag: VF_A0191 Name: fhuE Funciton: Putative ferrichrome-iron receptor Locus tag: VF_A0192 Name: PF11932 Funciton: hypothetical protein Locus tag: VF_A0193 Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein Locus tag: VF_A0194 Name: exbB2 Funciton: TonB system transport protein ExbB2 Locus tag: VF_A0195 Name: exbD2 Funciton: TonB system transport protein ExbD2 Locus tag: VF_A0196 Name: tonB Funciton: Periplasmic protein TonB Locus tag: VF_A0197 Name: VC1543 Funciton: TPR domain protein, putative component of TonB system
fhuE-PF11932-exbB1-exbB2-exbD2-tonB-VC1543	-83	5.9	AAATGGTAACAATTATCATTT	VF_A0191
Vibrio harveyi ATCC BAA-1116
Position: -97 Score: 5.4355 Sequence: AAATGGTAATAGTTGTCATTT Locus tag: VIBHAR_06761 Name: fhuE Funciton: Putative ferrichrome-iron receptor Locus tag: VIBHAR_06760 Name: PF11932 Funciton: hypothetical protein Locus tag: VIBHAR_06759 Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein Locus tag: VIBHAR_06758 Name: exbB2 Funciton: TonB system transport protein ExbB2 Locus tag: VIBHAR_06757 Name: exbD2 Funciton: TonB system transport protein ExbD2 Locus tag: VIBHAR_06756 Name: tonB Funciton: Periplasmic protein TonB Locus tag: VIBHAR_06755 Name: VC1543 Funciton: TPR domain protein, putative component of TonB system
fhuE-PF11932-exbB1-exbB2-exbD2-tonB-VC1543	-97	5.4	AAATGGTAATAGTTGTCATTT	VIBHAR_06761
Vibrio parahaemolyticus RIMD 2210633
Position: -98 Score: 5.33163 Sequence: AAATGGTAATACTTATCACTT Locus tag: VPA0150 Name: fhuE Funciton: Putative ferrichrome-iron receptor Locus tag: VPA0151 Name: PF11932 Funciton: hypothetical protein Locus tag: VPA0152 Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein Locus tag: VPA0153 Name: exbB2 Funciton: TonB system transport protein ExbB2 Locus tag: VPA0154 Name: exbD2 Funciton: TonB system transport protein ExbD2 Locus tag: VPA0155 Name: tonB Funciton: Periplasmic protein TonB Locus tag: VPA0156 Name: VC1543 Funciton: TPR domain protein, putative component of TonB system
fhuE-PF11932-exbB1-exbB2-exbD2-tonB-VC1543	-98	5.3	AAATGGTAATACTTATCACTT	VPA0150
Vibrio salmonicida LFI1238
Position: -82 Score: 5.75632 Sequence: AAATAAAAACGATTATCATTT Locus tag: VSAL_II0110 Name: fhuE Funciton: Putative ferrichrome-iron receptor Locus tag: VSAL_II0111 Name: PF11932 Funciton: hypothetical protein Locus tag: VSAL_II0112 Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein Locus tag: VSAL_II0113 Name: exbB2 Funciton: TonB system transport protein ExbB2 Locus tag: VSAL_II0114 Name: exbD2 Funciton: TonB system transport protein ExbD2 Locus tag: VSAL_II0115 Name: tonB Funciton: Periplasmic protein TonB Locus tag: VSAL_II0116 Name: VC1543 Funciton: TPR domain protein, putative component of TonB system
fhuE-PF11932-exbB1-exbB2-exbD2-tonB-VC1543	-82	5.8	AAATAAAAACGATTATCATTT	VSAL_II0110
Vibrio splendidus LGP32
Position: -124 Score: 5.42376 Sequence: AAATAGTAATAGTTATCACTT Locus tag: VS_II0677 Name: fhuE Funciton: Putative ferrichrome-iron receptor
fhuE	-124	5.4	AAATAGTAATAGTTATCACTT	VS_II0677

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing fhuE gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --