Orthologous regulated operons containing fbpB gene

Properties
Regulog:	Fur - Vibrionales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 447 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -2 Score: 5.51356 Sequence: TATTGATAATTGTTATCATTG Locus tag: PBPRA3184 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: PBPRA3183 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: PBPRA3182 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
fbpA-fbpB-fbpC	-2	5.5	TATTGATAATTGTTATCATTG	PBPRA3184
Vibrio angustum S14
Position: -46 Score: 5.55937 Sequence: TATTGAGAAACATTATCATTA Locus tag: VAS14_20031 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: VAS14_20036 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: VAS14_20041 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
fbpA-fbpB-fbpC	-46	5.6	TATTGAGAAACATTATCATTA	VAS14_20031
Vibrio cholerae O1 biovar eltor str. N16961
Position: 4 Score: 5.17978 Sequence: GATTGATAAAGGTTATCATTA Locus tag: VC0608 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: VC0609 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: VC0610 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
fbpA-fbpB-fbpC	4	5.2	GATTGATAAAGGTTATCATTA	VC0608
Vibrio fischeri ES114
Position: -53 Score: 5.93921 Sequence: TATTGATAATTATTATTATTA Position: -47 Score: 4.88867 Sequence: TAATTATTATTATTACCATTT Locus tag: VF_2151 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: VF_2150 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: VF_2149 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
fbpA-fbpB-fbpC	-53	5.9	TATTGATAATTATTATTATTA	VF_2151
	-47	4.9	TAATTATTATTATTACCATTT
Vibrio harveyi ATCC BAA-1116
Position: -41 Score: 5.294 Sequence: AACTGATAAACGTTATCATTA Locus tag: VIBHAR_03435 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: VIBHAR_03434 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: VIBHAR_03433 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
fbpA-fbpB-fbpC	-41	5.3	AACTGATAAACGTTATCATTA	VIBHAR_03435
Vibrio parahaemolyticus RIMD 2210633
Position: -40 Score: 5.294 Sequence: AACTGATAAACGTTATCATTA Locus tag: VP2491 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: VP2490 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: VP2489 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
fbpA-fbpB-fbpC	-40	5.3	AACTGATAAACGTTATCATTA	VP2491
Vibrio salmonicida LFI1238
Position: -53 Score: 5.37443 Sequence: TATTGATAAGTATTCTTATTA Locus tag: VSAL_I2588 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: VSAL_I2587 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: VSAL_I2586 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
fbpA-fbpB-fbpC	-53	5.4	TATTGATAAGTATTCTTATTA	VSAL_I2588
Vibrio vulnificus CMCP6
Position: -42 Score: 5.19986 Sequence: TACTGATAAACGTTATCATTA Locus tag: VV1_1660 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: VV1_1661 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: VV1_1662 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: VV1_1663 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
fbpA-fbpA-fbpB-fbpC	-42	5.2	TACTGATAAACGTTATCATTA	VV1_1660

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing fbpB gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --