Orthologous regulated operons containing VV20793 gene
Regulog: | Fur - Vibrionales |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor (activator) |
Biological process: | Iron homeostasis |
Effector: | Iron ion, (Fe2+) |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Photobacterium profundum SS9 | ||||
Position: -54
Score: 5.86297 Sequence: AATTGATAATGAATATCATTA
Locus tag: PBPRB1172
Name: VV20793 Funciton: Conserved hypothetical protein
Locus tag: PBPRB1173
Name: VV20794 Funciton: ABC transporter, ATP-binding protein |
||||
VV20793-VV20794 | -54 | 5.9 | AATTGATAATGAATATCATTA | PBPRB1172 |
Vibrio harveyi ATCC BAA-1116 | ||||
Position: -73
Score: 4.76887 Sequence: AAATGAAAACAAGTCGCACTT
Position: -50
Score: 5.81474 Sequence: AATTGATAATTAATTTCATTT
Locus tag: VIBHAR_05095
Name: VV20793 Funciton: Conserved hypothetical protein
Locus tag: VIBHAR_05094
Name: VV20794 Funciton: ABC transporter, ATP-binding protein |
||||
VV20793-VV20794 | -73 | 4.8 | AAATGAAAACAAGTCGCACTT | VIBHAR_05095 |
-50 | 5.8 | AATTGATAATTAATTTCATTT | ||
Vibrio parahaemolyticus RIMD 2210633 | ||||
Position: -80
Score: 4.81677 Sequence: AAATGAAAACAATACGCACTT
Position: -57
Score: 5.71754 Sequence: AATTGATAATCAATTTCATTT
Locus tag: VPA1494
Name: VV20793 Funciton: Conserved hypothetical protein
Locus tag: VPA1495
Name: VV20794 Funciton: ABC transporter, ATP-binding protein |
||||
VV20793-VV20794 | -80 | 4.8 | AAATGAAAACAATACGCACTT | VPA1494 |
-57 | 5.7 | AATTGATAATCAATTTCATTT | ||
Vibrio shilonii AK1 | ||||
Position: -73
Score: 5.06605 Sequence: AAATGATAATTACTTGCATTC
Locus tag: VSAK1_17632
Name: VV20793 Funciton: Conserved hypothetical protein
Locus tag: VSAK1_17627
Name: VV20794 Funciton: ABC transporter, ATP-binding protein |
||||
VV20793-VV20794 | -73 | 5.1 | AAATGATAATTACTTGCATTC | VSAK1_17632 |
Vibrio splendidus LGP32 | ||||
Position: -72
Score: 4.60032 Sequence: GAATGATTTTAATTTGCAATT
Position: -55
Score: 5.96017 Sequence: AATTGATAATAAATATCATTA
Position: -49
Score: 4.68025 Sequence: TAATAAATATCATTAACATTT
Locus tag: VS_II1376
Name: VV20793 Funciton: Conserved hypothetical protein
Locus tag: VS_II1377
Name: VV20794 Funciton: ABC transporter, ATP-binding protein |
||||
VV20793-VV20794 | -72 | 4.6 | GAATGATTTTAATTTGCAATT | VS_II1376 |
-55 | 6 | AATTGATAATAAATATCATTA | ||
-49 | 4.7 | TAATAAATATCATTAACATTT | ||
Vibrio vulnificus CMCP6 | ||||
Position: -95
Score: 4.80205 Sequence: AAATGATATAAACTTGCATTT
Position: -78
Score: 5.53046 Sequence: ATTTGATAATAATTTTCATTT
Locus tag: VV20793
Name: VV20793 Funciton: Conserved hypothetical protein
Locus tag: VV20794
Name: VV20794 Funciton: ABC transporter, ATP-binding protein |
||||
VV20793-VV20794 | -95 | 4.8 | AAATGATATAAACTTGCATTT | VV20793 |
-78 | 5.5 | ATTTGATAATAATTTTCATTT |