Orthologous regulated operons containing hutZ gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Photobacterium profundum SS9 | ||||
|
Position: -342
Score: 5.44464 Sequence: GAATAATATCAATTATCATTT
Position: -287
Score: 5.82117 Sequence: AAATAAGATTGATTATCATTT
Locus tag: PBPRA2102
Name: hutW Funciton: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
Locus tag: PBPRA2101
Name: huvX Funciton: Putative heme iron utilization protein
Locus tag: PBPRA2100
Name: hutZ Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
||||
| hutW-huvX-hutZ | -342 | 5.4 | GAATAATATCAATTATCATTT | PBPRA2102 |
| -287 | 5.8 | AAATAAGATTGATTATCATTT | ||
| Vibrio angustum S14 | ||||
|
Position: -206
Score: 5.44464 Sequence: GAATAATATCAATTATCATTT
Locus tag: VAS14_03953
Name: huvX Funciton: Putative heme iron utilization protein
Locus tag: VAS14_03948
Name: hutZ Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
||||
| huvX-hutZ | -206 | 5.4 | GAATAATATCAATTATCATTT | VAS14_03953 |
| Vibrio cholerae O1 biovar eltor str. N16961 | ||||
|
Position: -107
Score: 5.33368 Sequence: TAATAATAGCAATTATCAATT
Locus tag: VCA0909
Name: hutW Funciton: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
Locus tag: VCA0908
Name: huvX Funciton: Putative heme iron utilization protein
Locus tag: VCA0907
Name: hutZ Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
||||
| hutW-huvX-hutZ | -107 | 5.3 | TAATAATAGCAATTATCAATT | VCA0909 |
| Vibrio fischeri ES114 | ||||
|
Position: -100
Score: 5.68017 Sequence: TAATGAGATCAATTATCAATT
Locus tag: VF_1226
Name: hutW Funciton: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
Locus tag: VF_1227
Name: huvX Funciton: Putative heme iron utilization protein
Locus tag: VF_1228
Name: hutZ Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
||||
| hutW-huvX-hutZ | -100 | 5.7 | TAATGAGATCAATTATCAATT | VF_1226 |
| Vibrio harveyi ATCC BAA-1116 | ||||
|
Position: -154
Score: 5.31682 Sequence: TATTGCTAATCATTATCAACT
Position: -109
Score: 5.58166 Sequence: AAATAAGATCAATTATCAATT
Locus tag: VIBHAR_05245
Name: hutW Funciton: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
Locus tag: VIBHAR_05246
Name: huvX Funciton: Putative heme iron utilization protein
Locus tag: VIBHAR_05247
Name: hutZ Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
||||
| hutW-huvX-hutZ | -154 | 5.3 | TATTGCTAATCATTATCAACT | VIBHAR_05245 |
| -109 | 5.6 | AAATAAGATCAATTATCAATT | ||
| Vibrio parahaemolyticus RIMD 2210633 | ||||
|
Position: -109
Score: 5.58166 Sequence: AAATAAGATCAATTATCAATT
Locus tag: VPA0427
Name: hutW Funciton: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
Locus tag: VPA0428
Name: huvX Funciton: Putative heme iron utilization protein
Locus tag: VPA0429
Name: hutZ Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
||||
| hutW-huvX-hutZ | -109 | 5.6 | AAATAAGATCAATTATCAATT | VPA0427 |
| Vibrio salmonicida LFI1238 | ||||
|
Position: -147
Score: 5.77431 Sequence: AAATGAGATCAATTATCAATT
Locus tag: VSAL_I1750
Name: hutW Funciton: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
Locus tag: VSAL_I1749
Name: huvX Funciton: Putative heme iron utilization protein
Locus tag: VSAL_I1748
Name: hutZ Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
||||
| hutW-huvX-hutZ | -147 | 5.8 | AAATGAGATCAATTATCAATT | VSAL_I1750 |
| Vibrio shilonii AK1 | ||||
|
Position: -107
Score: 5.58166 Sequence: AAATAAGATCAATTATCAATT
Locus tag: VSAK1_22234
Name: hutW Funciton: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
Locus tag: VSAK1_22239
Name: huvX Funciton: Putative heme iron utilization protein
Locus tag: VSAK1_22244
Name: hutZ Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
||||
| hutW-huvX-hutZ | -107 | 5.6 | AAATAAGATCAATTATCAATT | VSAK1_22234 |
| Vibrio splendidus LGP32 | ||||
|
Position: -108
Score: 5.58166 Sequence: AAATAAGATCAATTATCAATT
Locus tag: VS_II0290
Name: hutW Funciton: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
Locus tag: VS_II0291
Name: huvX Funciton: Putative heme iron utilization protein
Locus tag: VS_II0292
Name: hutZ Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
||||
| hutW-huvX-hutZ | -108 | 5.6 | AAATAAGATCAATTATCAATT | VS_II0290 |
| Vibrio vulnificus CMCP6 | ||||
|
Position: -108
Score: 5.58166 Sequence: AAATAAGATCAATTATCAATT
Locus tag: VV21615
Name: hutW Funciton: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
Locus tag: VV21616
Name: huvX Funciton: Putative heme iron utilization protein
Locus tag: VV21617
Name: hutZ Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
||||
| hutW-huvX-hutZ | -108 | 5.6 | AAATAAGATCAATTATCAATT | VV21615 |