Orthologous regulated operons containing feoC gene
Regulog: | Fur - Vibrionales |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor (activator) |
Biological process: | Iron homeostasis |
Effector: | Iron ion, (Fe2+) |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Photobacterium profundum SS9 | ||||
Position: -36
Score: 5.62849 Sequence: AAATACTAATAATTCTTATTA
Locus tag: PBPRA1058
Name: feoA Funciton: Ferrous iron transport protein A
Locus tag: PBPRA1059
Name: feoB Funciton: Ferrous iron transport protein B
Locus tag: PBPRA1060
Name: feoC Funciton: Ferrous iron transport protein C |
||||
feoA-feoB-feoC | -36 | 5.6 | AAATACTAATAATTCTTATTA | PBPRA1058 |
Vibrio angustum S14 | ||||
Position: -36
Score: 5.82114 Sequence: AAATGCTAATAATTCTTATTA
Locus tag: VAS14_17796
Name: feoA Funciton: Ferrous iron transport protein A
Locus tag: VAS14_17801
Name: feoB Funciton: Ferrous iron transport protein B
Locus tag: VAS14_17806
Name: feoC Funciton: Ferrous iron transport protein C |
||||
feoA-feoB-feoC | -36 | 5.8 | AAATGCTAATAATTCTTATTA | VAS14_17796 |
Vibrio cholerae O1 biovar eltor str. N16961 | ||||
Position: -46
Score: 5.05628 Sequence: TAATAGTAATATTTCTTATTA
Locus tag: VC2078
Name: feoA Funciton: Ferrous iron transport protein A
Locus tag: VC2077
Name: feoB Funciton: Ferrous iron transport protein B
Locus tag: VC2076
Name: feoC Funciton: Ferrous iron transport protein C |
||||
feoA-feoB-feoC | -46 | 5.1 | TAATAGTAATATTTCTTATTA | VC2078 |
Vibrio fischeri ES114 | ||||
Position: -35
Score: 5.68968 Sequence: AAATAATAATGATTCTCACTA
Locus tag: VF_0833
Name: feoA Funciton: Ferrous iron transport protein A
Locus tag: VF_0834
Name: feoB Funciton: Ferrous iron transport protein B
Locus tag: VF_0835
Name: feoC Funciton: Ferrous iron transport protein C |
||||
feoA-feoB-feoC | -35 | 5.7 | AAATAATAATGATTCTCACTA | VF_0833 |
Vibrio harveyi ATCC BAA-1116 | ||||
Position: -42
Score: 5.70954 Sequence: TAATAATAATATTTATCATTA
Locus tag: VIBHAR_01363
Name: feoA Funciton: Ferrous iron transport protein A
Locus tag: VIBHAR_01364
Name: feoB Funciton: Ferrous iron transport protein B
Locus tag: VIBHAR_01365
Name: feoC Funciton: Ferrous iron transport protein C |
||||
feoA-feoB-feoC | -42 | 5.7 | TAATAATAATATTTATCATTA | VIBHAR_01363 |
Vibrio parahaemolyticus RIMD 2210633 | ||||
Position: -42
Score: 5.80368 Sequence: AAATAATAATATTTATCATTA
Position: -36
Score: 4.40561 Sequence: TAATATTTATCATTAGCAATA
Locus tag: VP0857
Name: feoA Funciton: Ferrous iron transport protein A
Locus tag: VP0858
Name: feoB Funciton: Ferrous iron transport protein B
Locus tag: VP0859
Name: feoC Funciton: Ferrous iron transport protein C |
||||
feoA-feoB-feoC | -42 | 5.8 | AAATAATAATATTTATCATTA | VP0857 |
-36 | 4.4 | TAATATTTATCATTAGCAATA | ||
Vibrio salmonicida LFI1238 | ||||
Position: -35
Score: 5.68968 Sequence: AAATAATAATGATTCTCACTA
Locus tag: VSAL_I2257
Name: feoA Funciton: Ferrous iron transport protein A
Locus tag: VSAL_I2258
Name: feoB Funciton: Ferrous iron transport protein B
Locus tag: VSAL_I2259
Name: feoC Funciton: Ferrous iron transport protein C |
||||
feoA-feoB-feoC | -35 | 5.7 | AAATAATAATGATTCTCACTA | VSAL_I2257 |
Vibrio shilonii AK1 | ||||
Position: -45
Score: 5.20311 Sequence: TAATGTTAATATTTCTCATTA
Locus tag: VSAK1_09003
Name: feoA Funciton: Ferrous iron transport protein A
Locus tag: VSAK1_09008
Name: feoB Funciton: Ferrous iron transport protein B
Locus tag: VSAK1_09013
Name: feoC Funciton: Ferrous iron transport protein C |
||||
feoA-feoB-feoC | -45 | 5.2 | TAATGTTAATATTTCTCATTA | VSAK1_09003 |
Vibrio splendidus LGP32 | ||||
Position: -42
Score: 5.03381 Sequence: TAATAACAATCTTTCTCATTA
Locus tag: VS_2234
Name: feoA Funciton: Ferrous iron transport protein A
Locus tag: VS_2233
Name: feoB Funciton: Ferrous iron transport protein B
Locus tag: VS_2232
Name: feoC Funciton: Ferrous iron transport protein C |
||||
feoA-feoB-feoC | -42 | 5 | TAATAACAATCTTTCTCATTA | VS_2234 |
Vibrio vulnificus CMCP6 | ||||
Position: -42
Score: 5.46965 Sequence: TAATAAAAATATTTCTCATTT
Locus tag: VV1_0149
Name: feoA Funciton: Ferrous iron transport protein A
Locus tag: VV1_0148
Name: feoB Funciton: Ferrous iron transport protein B
Locus tag: VV1_0147
Name: feoC Funciton: Ferrous iron transport protein C |
||||
feoA-feoB-feoC | -42 | 5.5 | TAATAAAAATATTTCTCATTT | VV1_0149 |