Orthologous regulated operons containing PF10952 gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Photobacterium profundum SS9 | ||||
|
Position: -54
Score: 5.40553 Sequence: TAATGCGAGTAATTATCATTA
Locus tag: PBPRA2569
Name: sodA Funciton: Manganese superoxide dismutase (EC 1.15.1.1)
Locus tag: PBPRA2570
Name: PF10952 Funciton: Protein of unknown function (DUF2753) |
||||
| sodA-PF10952 | -54 | 5.4 | TAATGCGAGTAATTATCATTA | PBPRA2569 |
| Vibrio angustum S14 | ||||
|
Position: -55
Score: 6.09746 Sequence: TAATGATAATAGTTATCATTA
Locus tag: VAS14_05603
Name: sodA Funciton: Manganese superoxide dismutase (EC 1.15.1.1)
Locus tag: VAS14_05608
Name: PF10952 Funciton: Protein of unknown function (DUF2753) |
||||
| sodA-PF10952 | -55 | 6.1 | TAATGATAATAGTTATCATTA | VAS14_05603 |
| Vibrio cholerae O1 biovar eltor str. N16961 | ||||
|
Position: -53
Score: 5.83701 Sequence: ACATGATAATAATTATCAATT
Locus tag: VC1009
Name: PF10952 Funciton: Protein of unknown function (DUF2753) |
||||
| PF10952 | -53 | 5.8 | ACATGATAATAATTATCAATT | VC1009 |
| Vibrio fischeri ES114 | ||||
|
Position: -70
Score: 5.8061 Sequence: AATTGATAATAATTCTCAGTT
Locus tag: VF_0927
Name: PF10952 Funciton: Protein of unknown function (DUF2753) |
||||
| PF10952 | -70 | 5.8 | AATTGATAATAATTCTCAGTT | VF_0927 |
| Vibrio harveyi ATCC BAA-1116 | ||||
|
Position: -58
Score: 5.34437 Sequence: ACTTGATAATAATTATCGTTT
Locus tag: VIBHAR_02989
Name: PF10952 Funciton: Protein of unknown function (DUF2753) |
||||
| PF10952 | -58 | 5.3 | ACTTGATAATAATTATCGTTT | VIBHAR_02989 |
| Vibrio parahaemolyticus RIMD 2210633 | ||||
|
Position: -57
Score: 5.34437 Sequence: ACTTGATAATAATTATCGTTT
Locus tag: VP2110
Name: PF10952 Funciton: Protein of unknown function (DUF2753) |
||||
| PF10952 | -57 | 5.3 | ACTTGATAATAATTATCGTTT | VP2110 |
| Vibrio salmonicida LFI1238 | ||||
|
Position: -61
Score: 6.13153 Sequence: TAATGATAATAATTCTCAATT
Locus tag: VSAL_I1864
Name: PF10952 Funciton: Protein of unknown function (DUF2753) |
||||
| PF10952 | -61 | 6.1 | TAATGATAATAATTCTCAATT | VSAL_I1864 |
| Vibrio shilonii AK1 | ||||
|
Position: -148
Score: 4.99466 Sequence: AAATGATAATCGTTATCGAAT
Position: -55
Score: 5.71637 Sequence: AAATGATAATCAATATCATCT
Locus tag: VSAK1_20819
Name: PF10952 Funciton: Protein of unknown function (DUF2753) |
||||
| PF10952 | -148 | 5 | AAATGATAATCGTTATCGAAT | VSAK1_20819 |
| -55 | 5.7 | AAATGATAATCAATATCATCT | ||
| Vibrio splendidus LGP32 | ||||
|
Position: -112
Score: 4.60763 Sequence: TATTAATAATCGATATTCTTT
Position: -105
Score: 4.37369 Sequence: AATCGATATTCTTTACTAATT
Position: -56
Score: 5.98817 Sequence: ACATGATAATAATTATCATTT
Locus tag: VS_0969
Name: PF10952 Funciton: Protein of unknown function (DUF2753) |
||||
| PF10952 | -112 | 4.6 | TATTAATAATCGATATTCTTT | VS_0969 |
| -105 | 4.4 | AATCGATATTCTTTACTAATT | ||
| -56 | 6 | ACATGATAATAATTATCATTT | ||
| Vibrio vulnificus CMCP6 | ||||
|
Position: -56
Score: 5.74859 Sequence: ACATGATAATAATTTTCATTT
Locus tag: VV1_3101
Name: PF10952 Funciton: Protein of unknown function (DUF2753) |
||||
| PF10952 | -56 | 5.7 | ACATGATAATAATTTTCATTT | VV1_3101 |